The URL can be used to link to this page

Home My WebLink AboutBATCH 12 - Supplemental - 1840 Spear Street928 Falls Road P.O. Box 485 Shelburne, VT 05482 November 3, 2004 Mr. Brian Robertson, Planning Associate City of South Burlington 575 Dorset Street South Burlington, Vermont 05403 Re: South Village PRD Calkins / South Village Communities, LLC Phase I / Master Plan Application Proposed Major Wetland Crossings Dear Mr. Robertson: Phone: 802-985-2323 Fax: 802-985-2271 E-Mail: mail@cea-vt.com In accordance with the request of the Development Review Board, we have prepared preliminary plans depicting the proposed means of crossing the existing streams and wetlands at the three proposed locations. We have outlined the design goals and features at each crossing in support of the preliminary designs depicted on the attached plans. Midland Avenue (Plan Sheet W3.0) Proposed goals and solutions for the creation of the connector roadway. 1. Maintain a low profile so as to minimize impacts on animal movements. This was achieved by proposing a road profile that was similar in height to the existing fill within the wetland. 2. Minimize wetland impacts - This was done through reducing the road width, minimizing the road fill height and utilizing side slopes of 2:1. A three - sided precast concrete box culvert with an open bottom is proposed to maintain a natural conveyance of water through this area. 3. Support a reduced width road (20) and recreation path (10) while providing a safe separation between the recreation path and the road edge. A curbed roadway coupled with a S grass median is proposed to provide the recommended safe separation. Mr. Brian Robertson Page 2 of 4 November 3, 2004 4. Provide treatment of the stormwater from the roadway - By making a low profile roadway, the ability to install a traditional stormwater collection and treatment system was lost. The road has been pitched from south to north with a 2% cross slope to move stormwater to the north shoulder. Two openings in the curb will remove stormwater from the road edge. In order to provide a level of treatment consistent with the current stormwater rules, a drainage swale has been designed to receive runoff from these two openings and direct the runoff to the upland areas on the east and west sides of the wetland. 5. Provide hydraulic capacity to pass the 50-year design storm - The low profile roadway design precluded the use of some culvert options. In order to provide the capacity to pass the 66 CFS 50-year design flow, a T wide x 1.5' high opening is proposed. This will replace the existing 15" culvert. This design provides a HW/D ratio of less than 1.5. "L" Street Crossing (Plan Sheet W1.0) Proposed goals and solutions for the creation of the connector roadway. 6. Maintain a profile consistent with the surrounding landform. The proposed fill heights have been kept to approximately 5 feet so that this crossing does not overwhelm the gentle topography to the west while tying in neatly to the rising land to the east. 7. Minimize wetland impacts - This was done through reducing the road width, minimizing the road fill height and utilizing side slopes of 2:1. A three sided 28' clear span precast concrete box culvert with an open bottom is proposed to maintain a natural conveyance of water through this area. 8. Support a reduced width road (20) and sidewalk (5) while providing a safe separation between the rec path and the road edge. A curbed roadway coupled with a 8' grass median to provide adequate snow storage is proposed. 9. Provide treatment of the stormwater from the roadway - The enclosed drainage system will direct the flows to a stormwater treatment facility on the north side of the crossing. 10. Provide hydraulic capacity to pass the 50-year design storm - The low profile roadway design required that a wider span structure be used. The hydraulic calculations indicate that a 18' wide structure would pass the 144 Mr. Brian Robertson Page 3 of 4 November 3, 2004 CFS design flows. The proposed structure clear span has been lengthened to 28' to minimize the wetland and conveyance corridor. "D" Street Crossing (Plan Sheet W4.0) Proposed goals and solutions for the creation of the connector roadway. 11. Maintain a profile consistent with the surrounding landform. The proposed fill heights are much greater for this structure than the other two crossings primarily because the stream is located in a deeper ravine. In order to connect the two sides of the ravine, the fill height approaches 13' at this crossing. 12. Minimize wetland impacts - This was done through reducing the road width and utilizing side slopes of 2:1. A three sided 28' clear span precast concrete box culvert with an open bottom is also proposed to maintain a natural conveyance of water through this area. 13. Support a reduced width road (20) and recreation path (10) while providing a safe separation between the rec path and the road edge. A curbed roadway coupled with a 5' grass median is proposed to provide the recommended safe separation distance between both the recreation path and sidewalk on the north side of the road. 14. Provide treatment of the stormwater from the roadway - The enclosed drainage system will direct the flows to a stormwater treatment facility on the north side of the crossing. 15. Provide hydraulic capacity to pass the 50-year design storm - The low profile roadway design required that a wider span structure be used. The hydraulic calculations indicate that a 18' wide structure would pass the 150 CFS design flows. The proposed structure clear span has been lengthened to 28' to minimize the wetland and conveyance corridor. "D" Street Crossing (Plan Sheet W2.0) Proposed goals and solutions for the creation of the connector roadway. 16, Maintain a profile consistent with the surrounding landform. The proposed fill heights have been kept to a minimum and will still maintain the minimum recommended road grade. Mr. Brian Robertson Page 4 of 4 November 3, 2004 17. Minimize wetland impacts - This was done through reducing the road width and utilizing side slopes of 2:1. An 18" culvert is proposed to pass the flows from this moderately sized watershed. 18. Support a reduced width road (20) and recreation path (10) while providing a safe separation between the rec path and the road edge. A curbed roadway coupled with a 5' grass median is proposed to provide the recommended safe separation distance between both the recreation path and sidewalk on the north side of the road.. 19. Provide treatment of the stormwater from the roadway - The enclosed drainage system will direct the flows to a stormwater treatment facility located to the west of this crossing. 20. Provide hydraulic capacity to pass the 50-year design storm - The design flows from this small contributing watershed can easily be accommodated by the proposed 18" culvert. This completes our summary of the design goals and features introduced into the three proposed wetland crossings. These plans will also be included in the updated plan sets which will reflect staff's latest comments. If you should have any questions, please feel free to contact me at 985-2323. Respectfully, David S. Marshall, P.E. Project Engineer \dsm Attachments: Plans (5 Full Size BM, 8 reduced to 11" x 17") cc: David Scheuer Michelle Holgate Rick Chellman David Raphael (all with attachments) C AI Let\01243\Master\RobertsonCrossings. wpd No Text No Text No Text No Text SOUTH V I L L A G E South Burlington, Vermont Community Larid Management Plan November 2004 This is a working document and subject to change. COMMUNITY LAND MANAGEMENT PLAN South Village, South Burlington, VT This plan provides a framework for the use, preservation, restoration and management of open space in South Village. Prepared for: South Village Communities, LLC c —4: _ South Burlington, VT .eta - Prepared by: LandWorks David Raphael, Civil Engineering Associates Principal David Marshall, Natalie Steen, Planner A Principal 211 Maple Street, P.O. Box 485 MW26 Shelburne, VT 05482 Middlebury, VT 05753 (802) 985-2323 (802) 388-3011 Applied Ecological Wildlife Consulting Services, Inc. David E. Capen Steven A. Apfelbaum University of Vermont 17921 Smith Road 364 Aiken Center A"Iiea ecological sernees, Inc: Brodhead, W153520 Burlington, VT 05405 (608) 897-8641 (802) 656-3007 THE INTERVALE The Intervale William D. mw-- Foundation Countryman Lindsey Ketchel, Art V. Gilman NOTE: Authored Director of Programs 868 Winch Hill Road Section 3 Only 2821ntervale Road Northfield, VT 05663 Burlington, VT 05401 (802) 485-8421 (802) 660-0440 I DRAFT TABLE OF CONTENTS INTRODUC PION 3 GENERAL DESCRIPTION 3 OVERALL GOALS 3 I SECTION 1. MANAGEMENT OF NEIGHBORHOOD ACTIVITIES AND FACILITIES 5 I 1.0 RECREATION PATH 5 2.0 SIDEWALKS 5 3.0 QUIET PATHS 5 3.1 Allowable Use 5 3.2 Management/Maintenance 5 3.3 Rules 5 3.4 Off -path Use 6 4.0 PARKING AND ACCE 6 5.0 PET 6 6.0 RECREATION FIELD AND FACILITIES 6 7.0 SIGNING 7 8.0 BACKYARDS 7 8.1 Maintenance and Fertilizing of Lawns, Gardens and Landscape 7 8.2 Fencing 7 8.3 Pets 7 8.4 Human/Wildlife Conflict Preventative Measures 8 8.5 Feeding of Wildlife 8 8.6 Maintenance/Enhancement of Natural Native Vegetation 8 Table 1. Sample List of Acceptable Plantings 9 8.7 Lighting 13 SECTION 2. ECOLOGICAL RESTORATION AND HABITAT MANAGEMENT PROGRAM 15 1.0 INTRODUCTION------ ----- 15 1.1 Benefits and Characteristics of Restoration 15 1.2 Restoration and Management Philosophy 16 1.3 Adaptive Restoration and Management 16 1 I DRAFT 2.0 WILDLIFE HABITAT CONSIDERATIONS AND ECOLOGICAL RESTORATION 16 I 2.1 South Village Design Process 16 2.2 Wildlife Use Patterns 17 2.3 Site -Specific Opportunities 17 3.0 RESTORATION AND MANAGEMENT ACTIVITIES 17 I 3.1 Introduction - 17 I 3.2 Scheduling 18 3.3 Monitoring & Reporting 18 3.4 Specialized Training 19 3.5 Restoration Stage Activities 19 I 3.6 Management Stage Activities 21 Table 2. Long -Term Management Activities 22 SECTION 3. AGRICULTURAL MANAGEMENT PLAN BY THE INTERVALE 23 1.0 BACKGROUND 23 2.0 GENERAL RECOMMENDATION 23 3.0 FARM 23 3.1 Farm Operations 24 3.2 Type of Products 24 3.3 Farm Recruitment Strategies 24 3.4 Transparent Farm Management and Goals 24 3.5 Long -Term Lease Agreements 24 3.6 Restrictions 24 4.0 MARKET 25 4.1 Farm Market Recommendations 25 5.0 LAND MANAGEMENT 26 5.1 Soil Maintenance and Improvement 27 5.2 Commitment to Farm Operation in Perpetuity 27 5.3 Wetlands and Wildlife Habitat 27 2 DRAFT • Provide recreational opportunities that are compatible with maintaining the integrity of the ecosystem. • Encourage pedestrian and bike use and discourage high-speed traffic through a series of well-connected streets, lanes, pedestrian paths, and bikeways. • Encourage the preservation and use of highly productive farmland. • Develop and manage open space with the least disturbance and impact possible. • Preserve and enhance natural features such as wetlands, floodplains, and drainageways. • Protect wooded areas to maintain viable wildlife habitat and maintain connections between habitats for movement. 4 INTRODUCTION GENERAL DESCRIPTION Several distinct types of open space have been designed or preserved in South Village to promote a healthy interaction between people and the environment. This plan shall apply to the following identified open spaces: Recreation Path - provides recreational opportunities for residents at South Village and links to the extensive network of recreation paths throughout South Burlington. The path navigates around the perimeter of the village and will provide residents with easy access to it. The layout takes advantage of the scenic and natural resources throughout the property and will provide an experiential journey through the surrounding preserved lands. Sidewalks - the pedestrian network provides residents with a safe and convenient way of accessing their community and the area beyond the neighborhoods. It provides an appropriate alternative to vehicular usage and allows residents to access areas that are not accessible by car. Front walks link to a network of 5' wide sidewalks that make connections to neighboring homes and help to reinforce the sense of community. The sidewalks also make connections to other alternative travel routes such as the recreation path and quiet paths. • Quiet Paths - located throughout the preserved areas of the site. They are a great amenity to the community linking residents with the surrounding natural landscape. Residents are able to experience and enjoy the native fauna and flora and the restoration areas and wetlands. • Neighborhood Green Spaces - internal neighborhood open spaces, including parks, commons, greens and pedestrian courtyards within a short walk to each home. • Working Farm - a 35 acre working farm, operated and managed by the Intervale Foundation that includes community supported agriculture and a native plant nursery. • Stormwater Treatment Train m (STT's) - include a series of ecologically designed swales used to channel storm water through native grasslands, forests, and wetlands designed to hold and beneficially utilize the run-off. STT's also provide valuable wildlife habitats and enhance community open spaces. • Restored and Preserved Open Space - the remaining open space in South Village, which includes over 150 acres of wetlands, woodlands, fields, mesic forests, savannas, pine forests, stream (riparian) system, wet native grasslands, emergent wetlands, drainage conveyance and infiltration opportunities (swales), and ephemeral wetlands. OVERALL GOALS The main purpose of this plan is to provide a framework for the use, preservation, restoration and management of open space in South Village and to: DRAFT SECTION 1. MANAGEMENT OF NEIGHBORHOOD ACTIVITIES AND FACILITIES 1.0 RECREATION PATH The recreation path navigates around the perimeter of the village and links with the City's existing bike path network. The recreation path is maintained and managed by the City of South Burlington and not under the purview of this plan. 2.0 SwEwAms Sidewalks within the road right-of-way are maintained by the City of South Burlington. The individual homeowner shall be responsible for maintaining front walks, which lead from their homes to the sidewalk network. This means maintaining a clear, unobstructed path during all seasons of the year, including snow removal. 3.0 QUiET PATHS Quiet paths are located throughout the preserved areas of the site. They are a great amenity to the community linking residents with the surrounding natural landscape. Residents are able to experience and enjoy the native fauna and flora and the restoration areas and wetlands. 3.1 Allowable Use Walking, hiking, running, birding, nature observation, cross-country skiing, snowshoeing and other foot traffic are all permitted uses on the quiet paths. Bicycles, horseback riding, mountain biking and other off -road or motorized uses are strictly prohibited except a wheelchair, baby carriage, or other like vehicle. 3.2 Management/Maintenance Management of trail systems and access should minimize conflicts among various user groups, minimize environmental impacts and provide for a quality recreational experience. The Community Association will be responsible for the general maintenance of the paths, which includes clearing of debris and other foreign matter. The paths will not be plowed during the winter months and patrons shall enter and use the paths at their own risk. 3.3 Rules Quiet paths are free and open to the public from dawn to dusk year round. Pets, including dogs, are strictly prohibited from the quiet paths. Patrons shall preserve the peace and quiet enjoyment of the trails. Noise should be kept at a volume that does not disturb other visitors, wildlife or people living in the area. Open fires and campfires are strictly prohibited. 2 DRAFT Overnight camping is not allowed anywhere along the quiet paths or within the open space network. Waste must be disposed of properly. Users are responsible for carrying out their own garbage. Burial of trash is not permitted. Animals will dig it up or it will become exposed later on for someone else to find. No person may harm, harass, hunt, trap or remove any animal, including mammals, fish, insects, birds, reptiles, or other living creature. Users shall not willfully mutilate, injure, destroy, thrash, or remove any live tree, shrub, vine, wildflower, grass, fern, moss, fungus or any other vegetation. No person shall collect or harvest dead wood or plants. Alcoholic beverages are prohibited. 3.4 Off -path Use Travelers shall stay within the width of the quiet path. Concentrating travel on trails reduces the likelihood that multiple routes will develop and scar the landscape or disturb wildlife. Off -path use is therefore strongly discouraged. As a general rule, travelers who must venture off -path should spread out to avoid creating paths that encourage others to follow. Avoid vegetation whenever possible, especially on steep slopes where the effects of off -path travel are magnified. Always choose the most durable surfaces available: rock, gravel, sand, compacted soil, dry grasses, or snow. 4.0 PARKING AND ACCESS Parking is available for all residents and visitors at the Village Center as well as on -street parking found throughout the village. Several access points to the quiet paths are found throughout the village. 5.0 PETS Pets pose significant threats to forest ecosystems, wildlife and the visitor experience. Dogs and other pets are therefore prohibited on the quiet paths and are limited to streets, sidewalks, the recreation path and other areas designated by the Community Association. Dogs must always be on a leash. Owners must keep pets under control at all times and immediately remove or bury their waste. 6.0 RECREATION FIELD AND FACILITIES Recreational fields and facilities at the school site and southwest locations are for school and resident use only, subject to rules and regulations that will be developed and posted by the Community Association. a *J 7.0 SIGMNG Signs will be installed that describe the acceptable use of recreational facilities, to identify access points, and to notify users of adjacent private property. They will be placed at all Quiet Path trailheads. They will also list the rules for the general use of the open space. Signing for the recreation path will be in accordance with City of South Burlington sign regulations; recreation path signs will be the responsibility of the City. 8.0 BACKYARDS 8.1 Maintenance and Fertilizing of Lawns, Gardens and Landscape Fertilizing lawns and gardens can accidentally lead to the contamination of surface waters - ponds, puddles, creeks, marshes, wetlands, lakes and rivers. Even a little too much can cause damage. To minimize the chance of excess nutrients getting into surface and ground waters, the following guidelines shall be followed: • Chemical fertilizers are prohibited. Only special slow release and organic fertilizers or compost may be used to fertilize lawns, gardens and landscape. Consult the "Living with Nature" handbook provided to each homeowner. • Pesticide and herbicide use is strictly prohibited. • Clippings should be left on the lawn, rather than removing them, to return nutrients to the lawn without the need for as much fertilizer. To reduce mowing, cut back on fertilizer and water. • Water should be conserved. The less excess flow, the less chance for leaching contaminants into any water. Use low flow devices such as drip irrigation and soaker hoses. Let lawns go somewhat brown in the summer. 8.2 Fencing Fences act as a barrier to the movements of wildlife. They often deter young and make them more vulnerable to predation and road kill. A poorly designed fence may lead to entanglement and eventual mortality, particularly during times of winter stress. • Use of privacy fencing, chain link fencing, and other restrictive access fencing should be limited to the immediate area surrounding the domicile and should not be used as a method to designate boundaries of larger lot sizes. • All backyards that abut wetland areas may only use natural fencing (hedge or wood). 8.3 Pets Growing pet populations become a problem to the natural environment and often harass or kill wildlife. Dogs, when left to roam, may negatively impact wildlife. House cats prey on small mammals, reptiles, amphibians, birds and other wildlife. Pets are also easy prey and may become part of the food chain, attracting larger predators (fox, coyote, bears) to urban environments. DRAFT • Dogs should be kept under the direct physical control of their owner and otherwise should be kept within a kennel or fenced area that effectively restricts their egress into open space areas. • Only cats kept indoors will be permitted in South Village. 8.4 Human/Wildlife Conflict Preventative Measures As humans encroach into wildlife habitat, it becomes necessary for residents to coexist with their surrounding environment. Each year, more and more bears rummage through garbage cans, skunks spray the family dog, raccoons occupy the attic, and white-tailed deer browse gardens and ornamental plantings. Because it is not practical to move nuisance animals to another area, it is imperative to modify human behavior to minimize conflict with their wild neighbors, as well as provide solutions before a problem develops. • Pet food should be kept within the domicile, garage or similar secure storage facility. Pet food should never be left outside. • Trash and recycling should be kept in tamper -proof containers, in a garage, or similar secured storage facility until the day of pick-up/disposal to prevent serving as an attractive nuisance to raccoons, skunks, dogs, and other wildlife and domestic species. 8.5 Feeding of Wildlife Many people feed deer, raccoons, wild turkeys, squirrels and other suburban wildlife, thinking they are helping these animals out by providing food. However, supplemental feeding encourages wildlife to become dependent on handouts, and often results in abnormally high populations of wildlife that become nuisances and spread disease. Furthermore, wildlife may lose their fear of humans and pets, leading to unfortunate encounters with aggressive pets and humans. • The feeding of all wildlife species except birds is prohibited. • Use of all bird feeders is discouraged. However, if feeders are used, they should be placed so they are inaccessible to raccoons, skunks, and other wildlife species that might cause damage or threaten human safety. 8.6 Maintenance/Enhancement of Natural Native Vegetation Grading, excavating, and construction are continually disturbing Vermont's landscape. Without special effort, naturally occurring plants and vegetation are rarely reestablished. Most often nonnative species invade such disturbed areas and spread into adjacent landscapes where they will be difficult to control. Nonnative species cover bare ground with dense greenery and sometimes with showy flowers, but may provide little in the way of habitat values or plant community diversity and structure. Nonnative species can establish monotypic stands that deplete soil moisture and shade the ground, eliminating chances that natural native plants will germinate and grow, and forcing wildlife to find edible food elsewhere, or starve. • Native vegetation shall not be altered and native herbaceous vegetation (grasses and (orbs) shall be maintained. When re-established, it should be maintained by methods that mimic natural processes. Mowing is strongly discouraged, except as required around the immediate vicinity of residences. DRAFT • Mowing is not permitted in wetlands and/or their buffers. Disturbance of wetland vegetation is limited to remediation activities. • Planting of native trees and shrubs is strongly encouraged for the bulk of the landscape palette but does not preclude the judicious use of non-native ornamentals as long as they are non-invasive species and approved by the South Village review process. A sample list of acceptable native plantings is provided in the table below: Tabk 1. Sample List of Acaprabk R mdw BOTANICAL NATIVE MATURE HEIGHT LANDSCAPE HARDINESS ZONE NAMEN FUNCTION & AND EXPOSURE ME�iMON AND SPREAD (S) FORM GROUND COVER Comptonia peregrine / massing, naturalizing 2 - 3' h 3b, sun or shade Sweet Fern 2, 6' s spreading DWARF SHRUBS (DECIDUOUS) lunipems communis specimen, ground 8 - 36" h 4a, sun var. depressa / cover 4 - 6" s Common juniper spreading or creeping Potentilia fruticosa/ foundation, border 11/2 - T h 3b, sun Bush Cinquefoil 2 - 4' s oval to round NOTE: There are many dwarf and shrub varieties and cultivars of native evergreen species such as Abies balsamea, luniperus virginiana, Picea glauca, Pinus strobus, Pntnus t6giniana, and Thuja occulentalis, which can be used. SMALL SHRUBS (DECIDUOUS) Aronia melanocarpa border, naturalizing 3 - 5' h 3b, sun or partial var. elata / 5 - 8' s shade Black chokeberry upright oval Dirca palustris/ specimen, border, 3 - 6' h 3b, sun or shade Leatherwood woodland edge 3 - 5' s oval to round 9 DRAFT BOTANICAL NATIVE MATURE HEIGHT LANDSCAPE (H) HARDINESS ZONE NAME / COMMON FUNCTION & AND EXPOSURE NAME AND SPREAD (S) FORM MR1111 IM SHRI IRS (DFCIDT J01-JS) Ilex aerticillata / border, naturalizing 6 - 19 h 3b, sun or partial Winterberry 6 - 10' s shade oval Vaccinium border, hedge, fruit 6 - 19 h 4b, sun or shade corymbosum/ garden 5 - 10' s Highbush Blueberry upright oval Viburnum cassinoides / naturalizing, border, 8 - 19 h 3b, sun or partial Witherod Viburnum, specimen 7 - 10' s shade Wild Raisin upright oval Viburnum dentatum / border, screen, 7 - 9' h 3b, sun or partial Arrowwood foundation 7 - 9' s shade Viburnum oval or round Viburnum trilobum/ specimen, border, 8 - 10' h 3b, sun or partial American screen, naturalizing 6 - 10' s shade Cranberrybush Viburnum upright oval I ARC.F SHRUBS AND SMALL TREES (DECIDUOUS) Amelanchier arborea / specimen, 25 - 40' h 3b, sun or partial Downy Serviceberry naturalizing 15 - 30` s shade upright oval Amelanchier x specimen, 15 - 25` h 4a, sun or shade grandif lora / naturalizing 10 - 18' s Apple Serviceberry upright oval Amelanchier laevis / specimen, 15 - 25' h 3b, sun or shade Allegheny naturalizing 8 - 12' s Serviceberry upright oval 10 DRAFT BOTANICAL NATIVE LANDSCAPE MATURE HEIGHT HARDINESS ZONE NAME / COMMON FU& (H) AND EXPOSURE NAME BORON AND SPREAD (S) Carpinus caroliniana / specimen, 20 - 30' h 3b, sun or shade American Hornbeam woodlands, 15 - 20' s naturalizing upright oval Corpus alternifolia / specimen, border 12 - 20' h 3b, sun or shade Pagoda Dogwood 8 - 12' s upright oval Prunus virginiana / wildlife, border, 15 - 25' h 3b, sun or partial Chokecherry woodland edge 12 - 15' s shade oval to round Sorbus decora / specimen 20 - 25' h 3b, sun Showy Mountainash 15 - 20' s upright oval Viburnum specimen, border, 12 - 15' h 3b, sun or shade prunifolium/ massing 8 - 12' s Blackhaw Viburnum upright oval MFi)iI TM ANT) I.ARCTF TRFFS (I)F-CIDIJOIJS) Acer rubrum / shade tree, specimen 50 - 70' h 3b, sun Red Maple 40 - 50' s upright oval Acer saccharinum / shade tree, specimen 70 - 80' h 3b, sun Silver Maple 60 - 80' s broad oval to irregular Acer saccharum / shade tree, specimen 70 - 80' h 3b, sun or partial Sugar Maple 40 - --'s shade - upright oval to round Betula alleghaniensis / specimen, shade tree, 40 - 60' h 3b, sun or partial Yellow Birch naturalizing 40 - 50' s shade upright oval, round 11 DRAFT BOTANICAL NATIVE LANDSCAPE MATURE HEIGHT HARDINESS ZONE NAME / COMMON FUNCTION & (H) AND EXPOSURE NAME FORM AND SPREAD (S) Betula lento. / specimen, shade tree, 40 - 55' h 3b, sun or partial Black Birch naturalizing 35 - 45' s shade upright oval Betula papyrifera / specimen, shade tree, 60 - 75' h 3b, sun Paper or Canoe Birch naturalizing 30 - 50' s upright oval Carya ovata / specimen, shade tree 60 - 75' h 4b, sun Shagbark Hickory 40 - 50' s upright oval Fagus grandifolia / specimen, shade tree 60 - 80' h 3b, sun American Beech 40 - 50' s upright oval Ostrya virginiana / specimen, shade tree, 40 - 50' h 4a, sun, partial shade Hop -hornbeam street tree 30 - 40' s upright oval Prunus serotina / woodland edge, 60 - 75' h 3b, sun Black Cherry naturalizing 30 - 50' s upright oval to irregular Quercus bicolor/ specimen, shade tree 50 - 70' h 3b, sun Swamp White Oak 40 - 50' s upright oval, round Ti" americana / specimen, shade tree, 70 - 80' h 3b, sun American Linden street tree 40 - 50' s upright oval EVERGREEN TREES Abies balsamea / specimen, screen, 50 - 70' h 3b, sun or partial Balsam Fir windbreak, accent 20 - 30' s shade pyramidal 12 DRAFT BOTANICAL NATIVE LANDSCAPE MATURE HEIGHT HARDINESS ZONE NAME/COMMONFUNCTION & AND EXPOSURE NAME FORM AND SPREAD (S) Iuniperus virginiana / screen, hedge 25 - 35' h 4b, sun Eastern Red Cedar 15 - 20' s pyramidal Picea glauca / specimen, screen, 40 - 60' h 3b, sun White Spruce windbreak 15 - 25' s pyramidal Pinus resinosa / screen, windbreak 60 - 75' h 3b, sun Red Pine 25 - 35' s pyramidal Pinus strobus / screen, windbreak, 60 - 75' h 3b, sun Eastern White Pine shade tree, specimen 25 - 35' s pyramidal Thuja occidentalis / screen, hedge, 30 - 40' h 3b, full sun, partial American arborvitae, specimen 10 - 20' s shade White Cedar pyramidal Tsuga canadensis / specimen, screen, 50 - 75' h 3b, sun or shade Canadian Hemlock hedge 25 - 35' s pyramidal 8.7 Lighting Although sometimes necessary, outdoor lighting can have negative ecological effects on plants, animals, and even people. Light pollution threatens wildlife by disrupting biological rhythms and otherwise interfering with the behavior of nocturnal animals. The effects may be subtle and go unrecognized but can also be deadly. Research has revealed that behavioral patterns of insects, birds, fish, mammals and other wildlife are altered in significant, detrimental ways. For example, nocturnal birds use the moon and stars for navigation during their bi-annual migrations. When they fly through a brightly lit area, they become disoriented and are susceptible to collisions with over -lit structures. • Individual lights on buildings or in yards, other than what is necessary for safety, is discouraged. Homeowners who want to add additional outside lighting will need to I apply to the Developer or Community Association for approval. Light sources will need to be hidden or pointed down to avoid or reduce excessive glare and visual impact I on wildlife. The lowest level of illumination possible is desired. 13 • Short-term seasonal decorations (i.e. Christmas lights) shall be displayed for a maximum of 6 weeks and subject to Community Association review and guidance. 14 DRAFT SECTION 2. ECOLOGICAL RESTORATION AND HABITAT MANAGEMENT PROGRAM NOTE: Any work proposed under the restoration and management program will be subject to review by the Agency of Natural Resources, a Conditional Use Determination, and a Vermont General Permit. 1.0 INTRODUCTION This Ecological Restoration and Habitat Management Program has been designed for the South Village residential development project in South Burlington, Vermont. This program is based on the following design objectives: 1. Restore the ecology, diversity, and beauty of native plant communities in conservation preserves. 2. Improve the ecological function and beauty of the communal open space and other areas by integrating ecological restoration with native landscaping. 3. Provide for the enjoyment of the conservation preserves. 4. Develop a longterm ecological stewardship program for the open space. 1.1 Benefits and Characteristics of Restoration Restoration of native plant communities improves the health of ecosystems, including wildlife habitat and ecological function (e.g., stormwater management). The restoration of a complex native vegetation structure and rich biodiversity in South Village's woodlands, wetlands, wet prairies and native upland grasslands and forests will provide opportunities for populations of breeding birds, invertebrates, mammals, and other wildlife. The ecological benefits of restoration are many. The deep and fibrous root systems of the upland native plant communities stabilize and improve soil, capture and slow runoff from developed and landscaped areas, and speed the absorption of water into the soil and groundwater. Hidden from view, but just as important, the leaching of nitrogen and phosphorus —major contributors to water pollution and algae blooms —is slowed and water quality downstream improved. Many other functions, from seed bank replenishment to the provision of food for wildlife, are enhanced by restoration. The first two to three years of the restoration process are the most difficult and costly. To firmly take hold in restorations, the native plants we favor must be helped to compete against established weeds, such as European buckthorn, Tartarian honeysuckle, garlic mustard, reed canary grass, and other introduced non-native species. Tasks will be carefully laid out and budgeted so that after the native plants are established, routine maintenance of the restored plant communities can begin. This routine maintenance is much less costly than the beginning stages of restoration. 15 DRAFT 1.2 Restoration and Management Philosophy The philosophy of restoration focuses on creating ecologically valuable biological communities within the context of a developed or disturbed landscape. This document provides information that serves as a baseline for assessing the effectiveness of future restoration and management efforts. The goal of restoration - creating a quality environment - is represented by the plant life in the form of native plant communities. The assumption is that if the plant communities are restored, wildlife populations, ecological functioning, and human enjoyment will be enhanced. This project will focus on creating and restoring diverse ecological systems adjacent to developed areas. Presettlement vegetation was used as a reference to guide the restoration work, and it is our intent to create plant communities that are native to the area, and if possible native to the site. However, changes in the landscape and existing conditions often preclude the possibility of re-creating the original landscapes present 150 years ago. Where plant communities are adjacent to developed or traditionally landscaped areas, we will integrate the restorations with the adjacent lands. Ecological restoration does not rule out opportunities for ornamental gardens and plantings that employ colorful, attractive native species. Properly designed and maintained, native plantings of shrubs, wildflowers, and grasses will result in an intriguing, often stunning display of color and form that blends into the more natural conservation areas or forms a transition from restored plant communities to developed areas. At South Village, landscaping concepts will be blended with carefully selected mixes of native plants to create interesting and beautiful displays for residents and visitors. Limited trails and gathering spots will be designed to invite walkers through the restored plant communities and plantings. Vistas will be enhanced by plantings designed to draw the eye from one colorful feature to another. 1.3 Adaptive Restoration and Management Restoration and management programs need to be flexible because of the variability exhibited by the temporal and spatial resources addressed by a plan. Programs need at times to be changed in response to new data and derived insights resulting from regular monitoring. For these reasons, this program should be viewed as being neither conclusive nor absolute. This program is a starting point in an ongoing process of restoring the site's biodiversity and natural processes. Regular monitoring during the restoration process will provide feedback on the program's effectiveness, and generate information to evaluate and justify the need for changes. This process of evaluation, adjustment, refinement, and change is called "adaptive management." Adaptive management is a tool that is fundamental to the restoration, management, maintenance, work described in this program. 2.0 WILDLIFE HABITAT CONSIDERATIONS AND ECOLOGICAL RESTORATION 2.1 South Village Design Process South Village was designed after a natural resource mapping was conducted of the property. During the inventory the land's current ecological conditions and health were mapped and described for the vegetation systems and wildlife resources in the property. t6 DRAFT The inventory also mapped drainage patterns, depressional topographic features, poor soils areas, erosion risk, and other conditions on the landscape. In addition, field wildlife studies to understand habitat use by wildlife were undertaken. Before the development design began, an ecological restoration plan was prepared that focused on 1) increasing native plant community diversity, 2) stabilizing soils, 3) providing improved wildlife habitat opportunities, 4) reducing long-standing impacts of the presently abandoned agricultural uses on the land including ditched and tiled lands, graded and land filled areas, and 5) implementing ways to improve the stormwater functions of the land by reducing current water yields, improving the quality of water leaving the land, and stabilizing the hydraulics from current runoff, particularly in wetlands and the associated unnamed tributary stream. Planning for the development followed this ecological and wildlife inventory, and restoration and stormwater conceptual design process. 2.2 Wildlife Use Patterns Wildlife use of the South Village property was most strongly associated with forested wetlands and mature forest areas near the eastern boundary (Capen 2004`). Birds, too, were most numerous on the eastern and northeastern portions of the property, the product of the intersection of forest, wetland, and grassland habitat types. Most of the land west of the wetland is highly degraded and dominated by birds foot trefoil (Lotus corniculatus) and other planted and typical fallowed farm field plants such as Canada goldenrod (Solidago canadensis), European brome grass (Bromus inermis), quack grass (Agropyron repens) and little else. 2.3 Site -Specific Opportunities Connecting Native Plant Communities The South Village site presents opportunities for connecting native plant communities, using greenways and other natural open space corridors. Employing natural ecological systems for stormwater management, such as the Stormwater Treatment TrainTm (ST-I), will help achieve this objective. The proposed site design creates a substantial greenway that connects the site's south-central oak savanna and wetland area to the Scientific and Natural Area located south of the site. This greenway will provide valuable wildlife habitat, travel corridors, and opportunities for ecological stormwater management, habitat restoration, and many other ecological improvements. 3.0 RESTORATION AND MANAGEMENT ACTIVITIES 3.1 Introduction The Ecological Restoration and Management Program for South Village is comprised of two stages: a) Restoration Stage: The restoration stage is the period when major efforts are undertaken to restore vegetation and biological diversity and begin the process of restoring ecological functions. The restoration stage includes enhancement 1 Capen, D. E. 2004. South Village wildlife assessment. Unpublished report submitted to Retrovest Companies. 9pp. 17 DRAFT of existing degraded native plant communities as well as restoration of native plant communities that once occupied the site. Tasks during this phase include reducing undesirable species and planting native species. The period of time required to conduct the restoration stage depends on the condition of the ecological system, the level of effort needed, and the opportunities and constraints (e.g., access, weather, biological response). Typically a restoration stage of three years for a given area is required, followed by the management stage for that area. b) Management Stage. After achieving initial restoration goals, the restoration process shifts to a reduced -intervention, lower -cost management stage. Tasks during this stage include spot herbicide treatments, remedial planting, and prescribed burning. To carry out the restoration and management stages, ecological concepts and prescriptions will be written and scheduled over a multi -year period for each of several management units that are developed for a site. Management units are typically ecologically significant groupings of plant communities that are convenient to manage. Tasks are performed on a regular schedule, guided by annual ecological monitoring. Management strategies are usually completed on a rotational basis. For example, areas that may be managed with prescribed burning are often split into management units demarcated by existing and convenient firebreaks, such as hiking trails or surface water features. In a given year, perhaps two management units on the site will be burned, and the following year another two units will be burned, and so on. While certain management tasks will occur only in particular management units in a given year, annual monitoring and other management tasks will occur throughout the entire conservation area. Management units for South Village will be developed during finalization of the project. 3.2 Scheduling A difficult part of the restoration and management program is to organize the tasks in a clear and easily understood format. It is important that the program and schedule be flexible. Flexibility is necessary if activities that are planned require suitable weather conditions. Flexibility is also necessary because feedback from the monitoring program. may result in changes of strategy, techniques, and timing in order to satisfy the restoration goals. While prescribed burning is an ecologically effective and cost-effective technique, it may be desirable that portions of the conservation area be restored and managed using alternative methods (e.g., more intensive mowing or herbicide regimes). A more detailed description of specific restoration and management tasks to occur in particular restored or enhanced native plant communities is provided in Section 3.6 below. 3.3 Monitoring & Reporting Ecological monitoring provides important data about the effectiveness of the restoration and management program. It requires that the response of the native plant communities be checked regularly by measuring ecological indicators of plant community recovery. Effectiveness is judged against the goals and objectives of the project design. Goals can be 18 DRAFT modified over time as a result of this feedback. The results of annual monitoring are used to direct the restoration and management activities for the upcoming year. Photography is often used to document a chronosequence of ecological change during restoration and management. Reports detailing locations and dates of all restoration and management efforts undertaken and the ecological monitoring that occurred should be completed annually. This report is useful for noting the restoration progress, as well as assessing the need for modifications to the restoration and management program (i.e., adaptive management). 3.4 Specialized Training For many of the restoration tasks (e.g., prescribed burning, herbicide use, monitoring) specialized training (often involving licensing or certification), oversight, and guidance are required of personnel before the restoration program begins. Personnel and volunteers involved in prescribed burning, brush control, monitoring, seed collection, etc. should receive training commensurate with the activity in which they would be involved. Training is especially important for those activities that may have risk and safety implications (e.g., prescribed burning), but also for monitoring, where an accurate assessment of the response of the ecological system to the restoration treatments is required. 3.5 Restoration Stage Activities In our restoration work, AES aims to restore conservation areas to native plant communities specific to the project location, and where that is not possible or practical, we aim to restore areas to a community native to the site vicinity or region. Plant communities that will be enhanced and/or restored on the site include: • Mesic Forest • Brushlands • Oak Pine Forest • Oak Savanna • Grasslands • Wetlands In addition to the above listed plant communities, colorful native plant enhancement areas will be designed into the site's open space and features, and a no mow roadside mix will be installed along roadways to facilitate maintenance and firebreaks. The tasks for enhancing and restoring the various plant communities proposed for the site are outlined below, and a more detailed description including native plant species lists for each zone is to be included in future specifications. Mesic Forest, Brushlands • Remove invasive woody vegetation from the deciduous forest/woodland, including common buckthorn, black locust, and Tartarian honeysuckle. Selectively cut aggressive native woody species such as boxelder, prickly ash, elm, and green ash. This work may entail cutting and stump -treating with an appropriate herbicide, basal bark application with herbicide then allowing dead saplings to fall and be 19 DRAFT consumed over time by prescribed burning and/or decomposition, or foliar spray with herbicide. • Enhance forest/woodland areas using appropriate local ecotype saplings and seedlings including native oaks, chokecherry, juneberry, gray dogwood, and American plum, as well as appropriate forest/woodland forbs and graminoids. • Control invasive non-native herbaceous vegetation with prescribed burning and/or appropriate herbicides, and encourage growth of native forest/woodland species. Oak -Pine Forest • Remove invasive woody vegetation as described in 1 above. Selectively thin existing pines to allow sunlight to penetrate the canopy and reach the forest floor in areas. • Enhance the oak -pine forest area using appropriate local ecotype saplings and seedlings including white and red oaks, chokecherry, juneberry, gray dogwood, and American plum, as well as appropriate forbs and graminoids. • Control invasive non-native herbaceous vegetation as described in 1 above, and encourage growth of native species. Oak Savanna • Remove invasive woody vegetation from the existing oak savanna and selectively cut aggressive native woody species as described in 1 above. • Enhance and restore dry oak savanna patches within a grassland matrix, creating a mosaic of these two habitats. Use appropriate local ecotype saplings and seedlings of species currently occupying the area, including bur and Northern pin oak, as well as appropriate savanna forbs and graminoids. Control invasive non-native herbaceous vegetation as described in 1 above, and encourage growth of native species. Grasslands Enhance remnant and restored prairie areas on the site. Restore mesic native grasslands appropriate within the site's conservation areas. This work will require appropriate site preparation and control of invasive species (e.g., brome grass and reed canary grass) using prescribed burning and appropriate herbicides. Following site preparation, soil preparation and seeding/planting with appropriate, local ecotype, native prairie species will occur. Many portions of the site can be converted to native grassland systems with moderate effort. Wetlands Enhance the existing wetland and its surrounding agronomic weed dominated buffer area to diverse native plant communities. Prior to enhancement, the wetland will require control of invasive non-native species through application of appropriate herbicides and possibly prescribed burning. Appropriate training and permits for use of selective herbicides for use in the wetland and wetland buffer will be obtained from the State Department of Agriculture to allow these activities to W, �D-7.- occur. Herbicides are not broadcast sprayed during a restoration process. Instead they are wick applied directly to the target individual plants, which uses 1/25 the quantity of herbicide and also reduced exposure risk to other biota. The species of most concern in the site wetland are the invader from Southeast Asian, Reed canary grass (Phalaris arundinancea) and a hybrid grass introduced from Europe, called Giant reed grass (Phragmites communis). Reduction of these aggressive exotic species will allow the sedge meadow, wet prairie and emergent wetlands in the property to be enhanced and restored. Introduction of locally harvested native genetic seed stocks for wetland species, and management that stimulates the native seed bank response for the appropriate for the anticipated water regime, and the surrounding buffer areas should be restored with native mesic grassland, wet prairie, and appropriate woody vegetation. Numerous new wetlands will be created as a result of the site's Stormwater Treatment TrainT"r (STT) elements. Stormwater will flow into native vegetated swales and into infiltration areas (typically wet prairies and native upland grasslands) as well as deeper mixed emergent marshes. These wetland areas will be designed, graded, and planted to provide diverse native wildlife habitat that provides stormwater management functions as well as aesthetic and wildlife benefits. 3.6 Management Stage Activities Following the first three to five years of the restoration stage, the project will transition into the management stage. The management stage is critical for maintaining the value of the investment, perpetuating the plant community, and maximizing the ecological and aesthetic benefits of the native plant communities. Management activities will occur within designated management units. Appropriate management tasks for the entire conservation area and within particular management units will be guided by the annual monitoring. Monitoring provides feedback on the success of the restorations and enhancements, identifies developing problems, and is used to modify management techniques in order to achieve a higher success rate. Both long-term management and monitoring are intended to be conducted in perpetuity at South Village. In brief, long-term management of the site's conservation areas will include restoring the fire regime through prescribed burning where appropriate. Lowland hardwood forest rarely burned historically. However, during restoration and the early phases of ongoing management, surface fires are a great help in reducing non-native plant species cover and encouraging the growth of native groundlayer species. Wetlands, savanna and wet prairies and native upland grasslands, however, would benefit greatly from a regular schedule of prescribed burning. The Lake Champlain valley has a historic fire history and has been largely shaped by indigenous American -use of prescribed burning which has contributed to the unique flora and character of the forests, wetlands and grasslands still present to this day. The goal of burn management is to emulate the historic conditions that shaped the native plant communities in the valley. Limited use of appropriate physical (e.g., cutting) and chemical (e.g., herbicide) treatments may be necessary to control invasive plant species at the site. Species of particular concern 21 DRAFT observed at the site include common buckthorn, black locust, and Tartarian honeysuckle, reed canary grass, and smooth brome. The management tasks described in Table 2 below are repeated at certain intervals for different plant communities. Repetition is necessary to ensure that the restored condition of the plant communities is maintained over the long term. Table 2. LonrTerm Management Activities REMEDIAL PRESCRIBED SEEDING ANNUAL PLANT HERBICIDE BURNING & MONITORING COMMUNITY TREATMENT PLANTING Mesic forest 2-3 2-3 3-5 1 Brushlands 2-3 2 3 1 Oak -Pine Forest 5-7 1-2 2-3 1 Oak Savanna 2-3 1-2 2-3 1 Mesic Grassland 2-3 2-3 3-5 1 Wet prairie/Sedge 34 1-2 3-5 1 Meadow Emergent Wetland 34 1-2 3-5 1 Notes: Numbers represent frequency of tasks (in years). Spot Herbicide Treatment and Remedial Seeding & Planting schedules assume that prescribed burning will be employed as a restoration and management technique. If prescribed burning is not employed as a restoration and management technique, mowing would likely be required. 22 �O T SECTION 3. AGRICULTURAL MANAGEMENT PLAN BY THE INTERVALE 1.0 BACKGROUND For the past sixteen years, the Intervale Foundation has played a leadership role in developing urban agriculture in the City of Burlington, Vermont. Today eleven independent farmers participate in the Farm Program. A total of 110 acres produce a wide variety of crops including flowers, mixed vegetables, fruit, eggs and grains. In addition to typical farm markets like farmers' markets, restaurant and grocery stores, the Intervale has supported the development of a Community Supported Agriculture (CSA) market option. Today, five farms at the Intervale offer CSA members a weekly basket of mixed vegetables, fruits and flowers for approximately 800 families during the harvest seasons from June thru October. In return members pay a share price for the entire season. The share price provides farmers with operating capitol in the beginning of the season and the members receive weekly baskets of the bountiful harvest throughout the growing season. Vermont Agriculture is experiencing a renaissance. While traditional farms are experiencing a loss in farm numbers and acres in production, there is a strong growth in both farms and acres in diversified agricultural production. For many individuals interested in launching their farms, formidable barriers still exist. One key challenge particular to Chittenden County and surrounding communities is access to affordable land and capital expense associated with startup operations. 2.0 GENERAL RECOMMENDATION Farmland in South Village poses a strategic opportunity to offer one to three new farm endeavors access to highly productive agricultural land. The South Village housing development, surrounding neighbors and community access make it ideal to launch a community supported suburban farm experience including a CSA, pick your own, and farm stand operation. South Village farmland could easily incorporate a direct to consumer and/or wholesale conservation nursery as well. 3.0 FARM The land size (approximately 35 acres) and configuration (mostly flat with road frontage), and soil types could create a thriving suburban agricultural opportunity. The acres available could accommodate ample production to effectively support one to three farm operations. Due to the close proximity to residential development we recommend a mixed vegetable and horticultural production utilizing organic practices. It will be necessary to develop a variety of farm infrastructure including, storage, walk-in coolers, hoop houses, greenhouses, farm residence, irrigation system and a variety of farm equipment. A percentage of lot sales could effectively capitalize farm infrastructure needs. Exemption and or special consideration should be applied to low-income units. 23 DRAFT 3.1 Farm Operations The site has the potential to house one to three typical organic mixed vegetable farms producing 30-35 varieties of vegetables, herbs, cut flowers and small fruits (like strawberries and raspberries). In addition, a Conservation Nursery would be able to provide ecologically sensitive native plant material to complement the unique environmental commitment that South Village proposes. 3.2 Type of Products • A typical organic mixed vegetable farm produces (30-35 varieties), flowers, herbs and a variety of fruits such as strawberries, raspberries and melons. • Small fruits like strawberries and raspberries. • Cut Flowers Native /Conservation Nursery would be able to provide ecologically sensitive plant material and complement the unique environmental commitment that South Village possesses. 3.3 Farm Recruitment Strategies It will not be difficult to find farmers to operate this parcel of land. Recent land offerings by the Vermont Land Trust in Chittenden County had over nineteen applicants. Both the local land trust and Intervale Foundation receive numerous inquires from individuals seeking farm opportunities in Chittenden County. Utilizing existing resources like agricultural organizations' websites, Land -Link and public relation outreach should generate ample farm candidates. A Comprehensive process and protocols for farm selection should be developed in 2005 and could be modeled after existing organizations like the Intervale and area land trusts who have extensive experience in farm recruitment and selection. 3.4 Transparent Farm Management and Goals South Village residents, neighbors and commuters will all have a strong awareness of the farm. The farm will operate with transparent farm management policies and goals. Mutual goals should be established between the landowner, residents and the farm operators. 3.5 Long -Term Lease Agreements Utilizing a comprehensive lease agreement will provide shared understanding and expectations between the landowners and the participating farms. The agreement will include land lease/rental fees and term, equipment protocols (fees if appropriate), renewal, termination, revision eligibilities and liability requirements. We recommend the farm carry comprehensive liability insurance. In addition the farmer will be required to hold harmless the property owners (indemnification). The farm will agree to follow all written protocols, including operational provisions. The Intervale Foundation has a comprehensive lease agreement that will serve as an excellent template. These agreements will provide the owners with appropriate land management oversight. 3.6 Restrictions All restrictions and acceptable agricultural practices will be present in the farm lease agreement and/or protocol section. All farmers will be required to meet organic 24 DRAFT production standards as per NOFA guidelines. Due to the close proximity to the homes no livestock product will be allowed. Limited hours of operation for machinery will be outlined in protocols but an emergency clause will ensure that the farmer could operate machinery to save the farm from catastrophic loss. In addition we recognize farm odors related to compost will require restriction in its location and management practice to minimize unpleasant odor experiences. 4.0 MARKET Dramatic interest in organic agriculture, increased interest in purchasing of local farm products and the number of CSA farmer operations indicate that a CSA and various direct market options would be viable for South Village. In just the past ten years, the number of certified organic farms in Vermont has grown from, 78 to 345. In the food industry the organic food products have been experiencing an annual growth rate of twenty percent since 1998. The number of CSA farmers in Vermont has grown substantially from a handful of farmers in 1990 to 40 farms offering this unique local access to local and/ or organic food. According to a recent Vermonter Poll conducted by the University of Vermont's Rural Studies department, there is significant interested amongst Vermonters to purchase local farm product. One of the identified barriers is access to product. These emerging consumers are becoming more health conscious and recognize the importance of access to fresh, healthy food for their families. With many small farms not structured and/ or viable, to access large grocery chains, creative and alternative shopping options like CSA's will help small farmers capture this market interest. 4.1 Farm Market Recommendations Community Supported Agriculture Primary market should consist of a Community Supported Agricultural (CSA) farm model. Due to the unique nature of the South Village development and South Burlington's commitment to supporting agricultural efforts in its south quadrant a CSA farm would link consumers and farmers for mutual benefit. Consumers will receive fresh and affordable produce and have the pleasure of being part of farm life. CSA's help farmers increase their financial security and develop strong relationships with their farm members. On average, CSA members' households save twenty to thirty percent over typical retail prices. In addition to products produced on the farm the CSA could easily offer local meats, cheese and breads for example, which are produced in the area. South Village CSA could accommodate between 450 to 500 members. We anticipate the farm -recruiting members from both residents of South Village and neighbors alike. Members of the farm will build a vibrant farm community in a unique suburban setting. Typically, CSA members help set the overall direction of the Farm through a steering committee, while others contribute by helping in the fields, making phone calls or planning special events. These special events like seasonal potlucks, annual meetings, and on -farm activities enhance the connection to the farm. 25 DRAFT • Distribution Beginning in mid June through early -November produce is available on a weekly basis. The member comes to the farm and collects their share of the harvest. Designated pickup days (twice a week) and times (typically from 3:00 to 6:30 p.m.) provide a friendly environment to see friends and neighbors. Product variety starts in June with lettuce, salad greens, peas, broccoli, zucchini, beans, basil and strawberries. Summer months provide shareholders with spinach, greens, baby beets, carrots, onions, tomatoes, cucumbers, peppers, tomatoes, eggplant, garlic, onions, melons and new potatoes. Fall months bring squash, pumpkins, kale, Brussels sprouts and root crops. • Share Options Members receive a portion of the harvest based on their membership levels. Generally, Small Shares feed 1-2 adults, Medium shares, 2-3 adults and Large shares, 3 or more adults. The CSA could also offer subsidized memberships and working memberships. Farm Stand and Pick Your Own Farm stands offer a more traditional shopping experience for the consumer and help reduce marketing costs like transportation, shipping containers and wholesale handling cost for the farmers. Special consideration is required for getting customers to the market and overcoming customers' perceptions of roadside markets as being less clean and having lower quality produce. High quality diversified crop production must meet three season (spring, summer and fall) inventory and customer interest. Facilities need to include sales area, adequate parking and roadway access. Effective and efficient market layout can attract customers, induce them to buy more, and reduce labor hours. More farm stands are incorporating agricultural experiences like pick -your own, entertainment and education. 5.0 LAND MANAGEMENT In evaluating the land it is apparent that the 35-acre parcel is well suited to support a variety of agricultural endeavors and approximately seventy acres should remain in a natural state. Existing Soil types and conditions would be able to support the cultivation of a wide variety of agricultural production. The designated wetland and wildlife habitat areas will be preserved and appropriate restoration practices implemented to ensure biodiversity and encourage native plant communities 5.1 Soil Maintenance and Improvement Unfortunately the land has been out of agricultural production for quite some time. After soil analysis has been completed we strongly recommend that cultivation and cover crop activity occur in the spring and fall of 2005. All lease agreements with farmers will require an annual land management review. Land use practices, soil amendments applied, cover crop, methods of tillage and insect and disease control should be monitored. Farmers should meet and/or exceed organic production practices. To ensure long term health of the soil one third of the parcel should remain in cover crop. 5.2 Commitment to Farm Operation in Perpetuity Since the farm operations will be providing critical benefits to the neighborhood and community alike we recommend that the developer and or landowners work with a land trust to identify options to ensure the land will remain in agriculture. One option to consider would be transferring development easements and stewardship oversight of a portion of the property to a land trust. This option is being explored with the Vermont Land Trust and other appropriate entities. There are a number of land trusts in the local, state and national arenas, which would be very interested in partnering with this creative community development model. 5.3 Wetlands and Wildlife Habitat A wetland and wildlife habitat assessment will identify areas that will require restoration and management efforts. Due to the proximity to construction and the ecological design efforts we do not anticipate any negative impact to sensitive areas by the farm operations. A construction protocol to mitigate any negative impact will be included in construction contracts consistent with Federal and local requirements. Appropriate planning, regenerative practices, plantings of native plants and natural efforts will ensure the wetland and wildlife habitat flourish and are compatible with the farm operations. 27 PAUL FRANK COLLINS P.C. November 12, 2004 Mr. Brian Robertson, Planning Associate City of South Burlington 575 Dorset Street South Burlington, VT 05403 Re: South Village PUD Calkins/South Village Communities, LLC Master Plan and Phase I Preliminary Plat Application Dear Mr. Robertson: Mark G. Hall mhall@PFC/aw.com As you know, on September 28, 2004, the South Burlington Development Review Board (the "DRB") conducted a public hearing on the Master Plan and Phase I Preliminary Plat applications of South Village Communities, LLC for the proposed "South Village" project on the Calkins Farm property along Spear Street. In an effort to clarify the legal issues at the last hearing, and to keep the project as transparent as possible, South Village submits the following responses to the issues raised by Mr. Vallee and Mr. Anderson. South Village also provides responses below to anticipated issues of contention between itself and Mr. Vallee. Munroe Brook and Bartlett Brook Watersheds At the hearing, Mr. Vallee intimated that the project will adversely affect the Bartlett Brook and Munroe Brook watersheds. Mr. Vallee's suggestion, however, is incorrect. While it is true that the Bartlett Brook and Munroe Brook watersheds run along the Calkins Farm property, the proposed development will have no adverse impact on these watersheds. South Village will be submitting information, pursuant to Section 12.03 of the South Burlington Land Development Regulations ("SBLDR") to the City's hydrology consultant, Heindel & Noyes, for review of the impact of the proposed development on the Bartlett Brook watershed. According to Section 12.03, after review, the City's consultant will provide South Village with non -binding recommendations regarding the stormwater management needs of the site. South Village will, to the extent possible, adopt the City's consultant's recommendations. To the extent necessary, South Village will also be applying to the Vermont Agency of Natural Resources for either a Federal National Pollution Discharge Elimination System ("NPDES") or a Watershed Improvement Permit ("WIP") for review of the project's impact on the both the Munroe Brook and Bartlett Brook watersheds. The applicable law ATTORNEYS AT LAW I www.PFC/aw.com One Church Street P.O. Box 1307 Burlington, VT 05402-1307 phone 802.658.2311 fax 802.658.0042 A Member of TerraLex@ The Worldwide Network of Independent Law Firms Mr. Brian Robertson, Planning Associate City of South Burlington November 12, 2004 Page 2 of 6 is in a state of flux due to a recent decision by the Water Resources Board. However, nothing in Article 12 (Surface Water Protection Standards) or Article 15 (Planned Unit Developments) of the SBLDR requires an applicant to obtain its State or Federal stormwater permits prior to receiving local approval. In fact, if the State standards are deemed to be more restrictive, the DBR could, pursuant to Section 15.14.E(1), simply forego local review under local standards and instead condition its approval of the project on the issuance of a State issued permit. After all is said and done, South Village is confident that all involved will conclude, as South Village's experts have, that the project will have no adverse impact on either watershed. Restricted Areas During the hearing, Mr. Vallee also claimed that development activities are prohibited on certain portions of the project site because they are within so-called "restricted areas" within the Southeast Quadrant of the City. However, Mr. Vallee failed to inform the DRB that pursuant to Section 9.08.B of the SBLDR, the DRB may allow development activities in "restricted areas" of Planned Unit Developments when the DRB "determines that such development activities are consistent with the intent and purpose of the Southeast Quadrant District." According to Section 9.01 of the SBLDR, one of the primary purposes of the Southeast Quadrant District is to encourage the "clustering of buildings and lots" in a manner that will preserve the open space character of the area. Through its innovative New Urbanist design, South Village meets this objective and promotes this purpose. As demonstrated at the public hearing, South Village utilizes compact settlement patterns, clustered neighborhoods and narrow non linear streets to create an abundance of open space, including parks, commons, greens and pedestrian courtyards, bikeways and walking trails. Additionally, approximately 35 acres will be devoted to a community - supported organic farm managed by the Intervale Foundation and all but a small portion of the 41 acres of wetlands on the site will be undisturbed and preserved as undeveloped open space. Mr. Vallee also neglected to inform the DRB that certain land development activities are allowed by right in "restricted areas". These activities include the construction of driveways, roads, utility services, and recreation paths. Therefore, the project, as proposed, is wholly consistent with the purpose and intent of the local zoning regulations pertaining to the Southeast Quadrant of the City. Mr. Vallee further claimed that Section 15.18 of the SBLDR prohibits development activities within "prominent ridgelines". Mr. Vallee went as far as presenting the DRB with a map showing Phase III of the project, often referred to during the hearing as "the Mr. Brian Robertson, Planning Associate City of South Burlington November 12, 2004 Page 3 of 6 bulge", as being within an "on -site prominent ridgeline".I Despite Mr. Vallee's assertion, Phase III of the project is not located within a "prominent ridgeline". The SBLDR's do not define the term "prominent ridgeline", so it is difficult to determine how Mr. Vallee came up with his self-serving definition and "prominent ridgeline" map of the site. Furthermore, it seems odd that the neighborhood to which Mr. Vallee is most opposed, Phase III, falls within the only area of the site identified by Mr. Vallee as a "prominent ridgeline". Finally, even if Mr. Vallee's self-serving definition were adopted and Phase III were within a "prominent ridgeline", Section 15.18 does not prohibit construction within "prominent ridgelines". It simply states that "prominent ridgelines" should be protected through the development plan. Wetlands In an effort to further expedite the process and to avoid future misstatements regarding the South Village project, we would also like to address issues that are sure to be raised at the next hearing. Specifically, we want to address how South Village is conformance with local wetlands standards. As set forth in the application materials, the South Village site contains approximately 41 acres of wetlands. However, the project, as shown in the sketch plan, will, for the most part, avoid these wetlands. The only impact to on -site wetlands will come from the narrow proposed roadway crossings and the conversion of wetlands along Spear Street to agricultural use (but the topography of these wetlands will not be changed, so they could in the future 'revert' to natural conditions). The narrow road crossings will include the connector road to Dorset Farms, and a second crossing of the stream in the buffer zone just downstream of the wetland edge. As set forth below, these nominal impacts will conform to the standards set forth in Section 12.02 of the SBLDR. Although not required, Section 12.02.D(1) of the SBLDR encourages applicants to submit a wetlands delineation to the DRB. South Village has submitted its wetlands delineation map to the DRB and all parties agree that this delineation is correct with regards to the impacted areas. Pursuant to Section 12.02.D(3) of the SBLDR, the DRB has the authority to invoke technical review by the City's wetlands consultant. The DRB has invoked its authority in connection with South Village and South Village is working with the City's consultant to ensure compliance with both the regulations and the desires of the City and its residents. Pursuant to Section 12.02.1)(4) of the SBLDR, the City's Natural Resources Committee must provide recommendations to the DBR in regards to on -site wetlands. If adopted by I Section 15.18 actually uses the term "prominent ridges" not "prominent ridgelines". Mr. Brian Robertson, Planning Associate City of South Burlington November 12, 2004 Page 4 of 6 the DRB, South Village will comply with the Natural Resources Committee's recommendations. Section 12.02.E(2) of the SBLDR requires an applicant to obtain a Conditional Use Determination ("CUD") from the Vermont Department of Environmental Conservation before encroaching into a Class II wetland. South Village will obtain a CUD before encroaching into on -site Class II wetlands. Some have suggested that an applicant must obtain a CUD before the DRB can grant its approval. This is simply not true. Section 12.02.E(2) does not require an applicant to obtain a CUD prior to the DRB's approval. In contrast, Section 12.02.E(2) simply requires an applicant to obtain a CUD before encroaching into Class II wetlands, which would be true even if no local permit or review were required. If our client fails to obtain the CUD before encroaching into a Class II wetland, any approval granted by the DRB would be considered conditional and encroachment into the a Class II wetland at the site would be prohibited by both the Vermont Wetlands Rules and SBLDR Section 12.02. Therefore, it is irrelevant when our client obtains the CUD, so long as it is obtained prior to "encroaching" into a Class II wetland at the site. Finally, the design of South Village achieves the objectives set forth in Section 12.02.E(3) of the SBLDR. Pursuant to Section 12.02.E(3), the DRB may allow encroachment into Class II wetlands buffers, Class III wetlands and Class III wetlands buffers if it finds that: (1) the encroachment will not adversely affect the ability of the property to carry or store floodwaters adequately; (2) the encroachment will not adversely affect the ability of the proposed stormwater treatment system to reduce sedimentation according to state standards; (3) the impact of the encroachment into the specific wetland functions and values identified in the field delineation and wetland report is minimized and/or offset by appropriate landscaping, stormwater treatment, stream buffering, and/or other mitigation measures. According to South Village's expert, Art Gilman of William D. Countryman, Environmental Assessment & Planning, the minimal wetlands encroachments on the South Village site will adhere to these standards. Moreover, South Village believes that South Village, through its innovative New Urbanist design, will become a model for reducing wetland impacts that will eventually be replicated across the State. Mr. Brian Robertson, Planning Associate City of South Burlington November 12, 2004 Page 5 of 6 Wildlife One other issue that will surely be raised at the next hearing is the impact of the project on wildlife habitats. However, the SBLDR do not specifically regulate wildlife habitats. Instead, the SBLDR regulate wildlife habitats generally in the context of other items, such as PUD's and wetlands. The following provisions are the only provisions that mention "wildlife habitats" in the SBLDR: • Section 2.02 of the SBLDR — Definition of "park". Any land owned by the public and open for use ... as a refuge for wildlife. Section 9.01 of the SBLDR — A Southeast Quadrant District (SEQ) is hereby formed in order to encourage... wildlife habitat preservation... Section 12.01 of the SBLDR — (Surface Water Protection Standards) It is the purpose of this Section to provide for the protection and improvement of the surface waters and streams within the City of South Burlington, Lake Champlain and Shelburne Bay, and the watersheds wholly or partially within the City. These regulations and standards are intended to lead to the establishment and protection of natural areas along the City's surface waters to provide improved protection for water quality and the provision of open space areas and wildlife habitat. • Section 12.02 of the SBLDR — (Surface Water Protection Standards) It is the purpose of this Section to provide appropriate protection to the City's wetlands resources in order to protect wetland functions and values related to surface and ground water protection, wildlife habitat and flood control. • Section 15.18.A of the SBLDR -The project's design respects and will provide suitable protection to ... wildlife habitats as identified in the Open Space Strategy. In making this finding the DRB shall utilize the provisions of Article 12 of these Regulations related to wetlands and stream buffers... • Section 15.18.B(3) of the SBLDR- Existing natural resources on each site shall be protected, including... wildlife habitats. • Section 15.18.B(6) of the SBLDR- A plan for the proposed open spaces and/or natural areas shall be established by the applicant describing the intended use and maintenance of each area... [E]nhancement of wildlife habitats in such plans for use and maintenance is encouraged. Due to the lack of specific regulations and standards with regards to wildlife habitats, the impact of South Village on wildlife habitats should be analyzed with regards to those Mr. Brian Robertson, Planning Associate City of South Burlington November 12, 2004 Page 6 of 6 areas that have substantive standards. Particularly, the DRB should look to the standards in Article 12 regarding wetlands and surface water protection standards. As set forth above (see Wetlands), South Village complies with the standards set forth in Article 12. As a result, the DRB should, to the extent necessary, make a finding that South Village complies with local provisions relating to wildlife habitats. Conchisinn South Village encourages further dialogue to ensure that its project is consistent with the goals and objectives of the DRB and residents of South Burlington. For more information please contact us at our Burlington office or visit South Village's website at www.southvillage.coin. Cordially yours, PAUL FRANK + COLLINS P.C. Mark G. Hall 387952 v1:3264-00014 PAUL FRANK + COLLINS P.C. January 4, 2005 Mr. Brian Robertson, Planning Associate City of South Burlington 575 Dorset Street South Burlington, VT 05403 Re: South Village PUD Calkins/South Village Communities, LLC Master Plan and Phase I Preliminary Plat Application Dear Mr. Robertson: Mark G. Hall mhall@PFC/aw.com I recently received a copy of a letter sent to the members of the City of South Burlington Development Review Board ("DRB") by attorney Jon Anderson on behalf of his client, Mr. Skip Vallee. Although my client, South Village Communities, LLC ("South Village"), believes that there is sufficient information in the record at this point on which the DRB can grant its approval of the proposed project, South Village submits the following responses to attorney Anderson's nonsensical arguments. Southeast Quadrant District Criteria In his letter, attorney Anderson, in relying upon the provisions of Section 15.18.B of the City South Burlington Land Development Regulations ("SBLDR" ), states that he and his client "believe that : (1) open space must be located to absolutely maximize the aesthetic value of the property; (2) building lots must be located to absolutely maximize this protection of open space, natural areas and scenic views; (3) wetlands wildlife habitats and corridors and prominent ridges must be absolutely protected; and (4) open space must be located to absolutely maximize the potential for combination with open space on adjacent properties." While attorney Anderson relies upon certain words and phrases in the provisions of 15.183 of the SBLDR to support his position, he neglects other words and phrases which are equally important and tend to refute his proclamation that these terms are "absolute". For instance, attorney Anderson cites Section 15.18.B(1) for the proposition that "open space must be located to absolutely maximize the aesthetic value of the property." However, attorney Anderson places no emphasis on the phrase "while allowing carefully planned development", which is also contained in Section 15.18.B(1). When you consider the entire language of Section 15.18.B(1), it is clear that South Village meets the standard set forth and that attorney Anderson is making yet another feeble attempt to distract the DRB. Another example of this is attorney Anderson's reliance upon certain words and phrases used in Section 15.18.B(3), to support his position that "wetlands wildlife habitats and corridors and ATTORNEYS AT LAW I www.PFC/aw.com One Church Street P.O. Box 1307 Burlington, VT 05402-1307 phone 802.658.2311 fax 802.658.0042 A Member of TerraLex@ The Worldwide Network of Independent Law Firms Mr. Brian Robertson, Planning Associate City of South Burlington January 4, 2005 Page 2 of 3 prominent ridges must be absolutely protected." When read in its entirety, Section 15.18.B(3) makes clear that protection does not amount to, as attorney Anderson suggests, an "absolute" prohibition on development activities within these areas. Section 15.18.B(3) states that "existing natural resources on each site shall be protected through the development plan..." (emphasis added). This phrase means that the development plan should recognize natural resources and preserve them when possible. South Village's development plan accomplishes this goal. In addition, attorney Anderson fails to recognize that South Village has designed the project to meet the provisions of Section 15.18.B(2). For instance, Section 15.18.B(2) states that "Building lots, streets and other structures shall be located in a manner that maximizes the protection of the open space character, natural areas, and scenic views of the Quadrant identified in the Comprehensive Plan, while allowing carefully planned development at the overall bases densities provided in these Regulations." As stated in my previous letters and as demonstrated at the last public hearing on this matter, South Village utilizes compact settlement patterns, clustered neighborhoods and narrow non linear streets to create an abundance of open space, including parks, commons, greens and pedestrian courtyards, bikeways and walking trails. Therefore, despite attorney Anderson's utilization of semantics, South Village meets the edicts of Section 15.18.B(2). Finally, the project, as proposed meets the provisions of Section 15.18.B(4) of the SBLDR. The open spaces on the Calkins property can be combined with the open space on adjacent property. The best example of this is the large wetland open space which abuts additional open space on an adjacent property. As he has in the past, attorney Anderson has misinterpreted the local regulations to suit his client's position. We again ask that the DRB not be persuaded and reject these tactics. Overall Base Density and Affordable Housing Bonus Attorney Anderson seems to suggest that the affordable housing density bonus provided under Section 13.14 of the SBLDR is not available to South Village because the property is located within the Southeast Quadrant of the City. However, attorney Anderson does not cite to the provisions of Section 13.14 to support his position. He does not cite Section 13.14 because it does not prohibit the use of density bonuses in the Southeast Quadrant of the City. Therefore, once again, attorney Anderson has misapplied the provisions of the local regulations and his position lacks merit as a result. It should also be noted that the number of units proposed by South Village is consistent with the formula contained in Section 13.14. The site contains 223 acres. Pursuant to Table C-2 of the SBLDR, the maximum allowable density per acre in the SEQ is 1.2 dwelling units. Therefore, the base zoning allows for the construction of 264 dwelling units (223 x. 1.2 = 267.7), and the density bonus under Section 13.14 allows for the construction of an additional 66 bonus units (267 x. 25 = 66.75), for a total of 333 units. Mr. Brian Robertson, Planning Associate City of South Burlington January 4, 2005 Page 3 of 3 Conclusion South Village encourages further dialogue to ensure that its project is consistent with the goals and objectives of the DRB and residents of South Burlington. For more information please contact us at our Burlington office or visit South Village's website at www.southvillage.com. Cordially yours, PAUL FRANK + COLLINS P.C. Mark G. Hall cc: Mr. Raymond Belair Jon T. Anderson, Esq. Mr. David Scheuer 401028 v1:8346-00005 10 BURAK ANDERSON MELLONI PLt: Counsellors at Law Mr. Ray Belair Zoning Administrator City of South Burlington 575 Dorset Street South Burlington, VT 05403 Michael L. Burak" Jon Anderson Thomas R. Melloni° Michael B. Rosenberg' Shane W. McCormack"$° Catcway Square • 30 Main Street Post Office Box 787 Burlington, Vermont 05402-0787 Phone: 802 862-0500 Fax 802 862-8176 e-mail: attorneyC)'tlawl.eom %mw.vtlawl.com 'Also admitted in Nem-Ibrk ❑Not vet admitted in Vermont •Also admitted in the District of Columbia tAlso admitted in Massachusetts September 7, 2004 Re: South Village Communities, LLC Master Plan and Phase 1 Applications Dear Ray: We believe the so-called Master Plan and Phase 1 Applications submitted by South Village Communities, LLC are deficient as outlined below. South Burlington Zoning Regulations (SBZR 1, 15.08B(1)) provides that a public hearing shall be held by the Development Review Board after submission of all requested information. Consistent with this restriction, so that we can all have a fair and complete opportunity to understand this project, we ask the South Burlington Development Review Board not to review South Village's Master Plan and Phase I applications until at least these deficiencies are resolved. 1. SBZR, § 15.08 establishes the contents for a preliminary plat application. The applicant fails to satisfy these requirements at least as follows: SBZR, § 1508A(1), SBZR, § 15.05 Requirements (2) The "names of owners of record of contiguous properties" have not been identified. On August 31, 2004, the developer revised its plans to include construction on what we understand to be the common land of Dorset Farms. The list of owners of record was not revised to include the owners of properties contiguous to the Dorset Farms common land. (5)(c) The location of the Bartlett Brook Watershed Overlay District is not depicted on any plan although the developer represents it to be shown on the so-called Existing Conditions Plan. BURAK MDERSON & MELLONIPLC Mr. Ray Belair Zoning Administrator City of South Burlington September 7, 2004 Page 2 (8) Existing water courses and wetlands have not been accurately identified. The Developer has yet to respond to the many "problem areas" identified in a meeting among the wetlands consultants including the consultant hired by the City of South Burlington on August 23, 2004. SBZR, § 15.08A(2), SBZR, § 14.05(D) Additional Requirements This section is applicable because the application is made as a PUD and includes multifamily dwellings. 1(c) The area and boundaries of building and setback lines as required by South Burlington have not been identified. (1)(d) Streams, drainage ways and associated stream buffer areas as set forth in Article 12 are not shown. 1(e) "Reservations, easements and areas dedicated to the public use" have not been shown. 4(b) The developer has not submitted "one set of preliminary plans, elevations, floor plans, and sections of proposed structures showing the proposed location, use, design and height of all structures ... landscaping ... screening ... any proposed division of buildings into units of separate occupancy and location of drives and access thereto." Only by reviewing such plans can the Development Review Board insure, for example, that the waivers sought by the developer may be granted "without jeopardy to public health, safety, and general welfare". SBZR, § 15.08B(3)(b). Not only has the developer not submitted the required information for the proposed school and multi -unit buildings, but it does not propose ever to submit the information for single and two-family homes. (4)(c) The location and layout of all off-street parking and loading areas has not been shown. In particular, such amenities are not shown for the proposed school or for any of the on -site residential parking. (4)(e) Lot areas for each lot and coverage calculations have not been submitted. BURAK ANDERSON & MELLONIvLC Mr. Ray Belair Zoning Administrator City of South Burlington September 7, 2004 Page 3 (4)(g) "Cut sheets for all proposed outdoor lighting" within the site have not been submitted. In particular, cut sheets for outdoor lighting for the school and the residences have not been submitted. (4)(h), (k), and (x) Landscaping, screening and buffering plans have not been submitted. Rather, all that has been submitted so far is a landscaping design showing the location of street trees. (4)(o) The location and design of all energy distribution facilities including electrical, gas and solar energy have not been submitted. (4)(r) The estimated cost of all site improvements has not been submitted. SBZR, § 15.08A(7) A preliminary design of a -X bridges or culverts which may be required has not been submitted. In particular, the Developer has not submitted the design for the culverts and bridge that it proposes for crossing waterways and wetlands. SBZR, § 15.08A(8) Temporary markers adequate to enable the Development Review Board to locate readily and appraise the basic layout in the field do not exist. SBZR, § 15.08(9) The list of waivers sought by the applicant appears nonsensical because it has not been updated to reflect recent bylaw amendments. For example, it refers to waivers in § 25.00 and in Table 25. The current bylaws end with article 17 and do not contain a Table 25. SBZR, § 15.08A(11) The surveyor has not signed the survey. 2. The developer has so far failed to submit information necessary to consider the impact of the wetlands encroachments that it proposes. SBZR, § 12.02 provides that such encroachments may be permitted "only in conjunction with the issuance of a Conditional Use Determination (CUD) by the Vermont Department of Environmental Conservation and positive findings by the DRB pursuant to the criteria in (3) below" as follows: (a) The encroachment(s) will not adversely affect the ability of the property to carry or store flood waters adequately; BURAK ANDERSON & MELLONII'u' Mr. Ray Belair Zoning Administrator City of South Burlington September 7, 2004 Page 4 (b) The encroachment(s) will not adversely affect the ability of the proposed stormwater treatment system to reduce sedimentation according to state standards; (c) The impact of the encroachment(s) on the specific wetland functions and values identified in the field delineation and wetland report is minimized and/or offset by appropriate landscaping, stormwater treatment, stream buffering, and/or other mitigation measures. We interpret this language as requiring the applicant both to obtain a CUD determination before South Burlington can complete its review and to submit data allowing the Development Review Board to independently analyze each of the above criteria. The developer has neither commenced the CUD process nor submitted an iota of data demonstrating compliance with the above standards. 3. The developer has failed to submit any information concerning the impact of its proposed development on stormwater. Rather, the developer improperly proposes that the "City rely upon the issuance of a Stormwater Discharge Permit from the State that the applicant has met its burden of proof relative the requirements of this section." Such issuance, however, if and when it occurs, is merely "evidence of sufficient management of stormwater for purposes of satisfying State requirements." SBZR, § 15.13F(1). The Development Review Board must still review state stormwater issues. Of course, the issuance of a state permit is not even evidence of satisfaction of municipal standards, which control if they are "more conservative." 4. The developer has yet to submit sufficient information concerning grading and erosion controls. SBZR, § 15.18A(2) requires the applicant to show that: Sufficient grading and erosion controls will be utilized during construction and after construction to prevent soil erosion and runoff from creating unhealthy or dangerous conditions on the subject property and adjacent properties. In making this finding, the DRB may rely on evidence that the project will be covered under the General Permit for Construction issued by the Vermont Department of Environmental Conservation. The applicant proposes too much impervious surface to qualify for a general permit. Yet, the applicant submits no plan for controlling erosion for the property. SBZR, § 16.03B provides: BURAK ANDERSON & MELLONIP►x Mr. Ray Belair Zoning Administrator City of South Burlington September 7, 2004 Page 5 (1) The smallest practical area of land should be exposed at any one time during development. When land is exposed during development, the exposure should be kept to the shortest practical period of time. (2) Land shall not be left exposed during the winter months. (3) Where necessary, temporary vegetation and/or mulching and structural measures shall be required by the Development Review Board to protect areas exposed during the development. (4) Sediment basins (debris basins, desalting basins, or silt traps) shall be installed and maintained during development to remove sediment from run off water and from land undergoing development. (5) The permanent final vegetation and structures shall be installed as soon as practical in the subdivision. (6) Adequate and permanent measures shall be taken at culvert outfalls to minimize or prevent erosion and disruption of drainageway areas. The applicant submits no plans showing its compliance with these regulations. We believe that the notice provision of the Permit Reform Bill now apply. "Said hearing [on the master plan and preliminary plat plan] shall be advertised and warned in accordance with this public notice provisions of the Vermont Planning Development Act". SBZR § 15.08 B (1). Those provisions require "notification" to be accompanied by information that clearly informs the recipient where additional information may be obtained and that participation in the local proceeding is a prerequisite to the right to take any subsequent appeal". 24 V.S.A. § 4464. Such notification must be given seven days before the hearing for preliminary plat approval. Of course, at least the project application must be complete at that time so that the notification accurately identifies where such application may be obtained. Very truly yours, Jo Anderson JTA\alb SAClient Matters\72835\Letters\jta belair.doc CIVI L it' 1 IGINs-EiRll Ir A �'S _':S�0C.I rE'50, lI IC1. 928 Falls Road P.O. Box 485 Shelburne, VT 05482 September 21, 2004 Mr. Brian Robertson, Planning Associate City of South Burlington 575 Dorset Street South Burlington, Vermont 05403 Re: South Village PRD Calkins / South Village Communities, LLC Master Plan and Phase I Preliminary Plan Application Dear Mr. Robertson: Phone: 802-985-2323 Fax: 802-985-2271 E-Mail: mail@cea-vt.com We are in receipt of Mr. Jon Anderson's September 7`h letter outlining his client's request for the submittal of additional information to support the current applications pending before the City of South Burlington Development Review Board. To assist all parties in understanding the status of the applications, we have provided a response to each one of Mr. Anderson's requests. 1. SBZR § 15.08 establishes the contents for a preliminary plat application. Most large projects go through a series of modifications as public input is added during the approval process. The South Village project is no different. The recent changes to the South Village project to reduce the development density in the southeastern portion of the site has required that the supporting plans be subsequently revised. Since the Master Plan approval technically needs to be addressed by the Development Review Board (DRB) prior to approving any preliminary plan application, we have focused on updating the Master Plan documents first. We will be completing the revisions to the more detailed documents supporting the preliminary plan shortly which will address many of the issues outlined below. SBZR § 1508A(1), SBZR § 15.05 Requirements (2) The "names of owners of record of contiguous properties" have not been identified. On August 31, 2004, the Developer revised its plans to include construction on what we understand to be the common land of Dorset Farms. The list of owners of record was not revised to include the owners of properties contiguous to the Dorset Farms common land. This is an inaccurate statement in that this information is shown on Sheet S'I of the plans Mr. Brian Robertson Page 2 of 8 September 21, 2004 submitted with the Master Plan application and the Preliminary Plan application. (5)(c) The location of the Bartlett Brook Watershed Overlay District is not depicted on any plan although the Developer represents it to be shown on the so-called Existing Conditions Plan. The Bartlett Bay Watershed Overlay District occupies a small portion of the project site along Spear Street. The intent of this district is to address stormwater impacts of development. The Existing Conditions Plan does not, and was not intended to include any of the overlay districts on it. There are separate sheets which show the more substantive restrictions (overlay components) on the plans that shape the proposed development of the land. This information can be added on the Grading and Drainage Plans so that the areas requiring review under §12.03 can be addressed. (8) Existing water courses and wetlands have not been accurately identified. The Developer has yet to respond to the many "problem areas" identified in a meeting among the wetlands consultants including the consultant hired by the City of South Burlington on August 23, 2004. The applicant has striven to coordinate the wetland delineation with representatives of the State of Vermont Department of Environmental Conservation Water Quality Division, the U.S. Army Corps of Engineers, and with Ms. Dori Barton from Arrowhead Environmental. As with any item requiring interpretation, there can be differing opinions. Mr. Art Gilman from Wm. D. Countryman Environmental Associates has addressed the issues raised by Ms. Barton. None of these areas impact the Master Plan concept or the Phase I components of the project. Those changes recommended by Mr. Gilman in his response letter will be integrated into the plans. SBZR § 15.08A(2), SBZR § 14.05(D) Additional Requirements This section is applicable because the application is made as a PUD and includes multifamily dwellings. 1(c) The area and boundaries of building and setback lines as required by South Burlington have not been identified. This is correct. Until the DRB and Planning Staff have had the opportunity to provide input on the proposed front, rear and side yard waivers, they have been left off the plans. Mr. Brian Robertson Page 3 of 8 September 21, 2004 1(d) Streams, drainage ways and associated stream buffer areas as set forth in Article 12 are not shown. Buffers restricting the development around the streams have been included within the wetland buffers shown on Sheet C.2. There is a 25' section of the stream at the southerly limits of the project where no development is proposed where the stream buffer will be added. 1(e) "Reservations, easements and areas dedicated to the public use" have not been shown. There are no easement or public land dedications proposed for this project. 4(b) The Developer has not submitted "one set of preliminary plans, elevations, floor plans, and sections of proposed structures shown the proposed location, use, design and height of all structures ... landscaping ... screening ... any proposed division of buildings into units of separate occupancy and location of drives and access thereto." Only by reviewing such plans can the Development Review Board insure, for example, that the waivers sought by the Developer may be granted "without jeopardy to public health, safety, and general welfare". SBZR § 15.08B(3)(b). The Preliminary Plan application is not seeking approval of the school or any of the 4 plus unit multi -family buildings at this time. Therefore this section is not applicable. Not only has the Developer not submitted the required information for the proposed school and multi -unit buildings, but it does not propose ever to submit the information for single and two-family homes. The applicant will be providing footprints of the proposed single, duplex and triplex buildings as part of the Preliminary Plan document update. 4(c) The location and layout of all off-street parking and loading areas has not been shown. In particular, such amenities are not shown for the proposed school or for any of the on -site residential parking. Any future school will be reviewed under a separate application. The City has historically not reviewed single family lot layouts other than for conformance with setback and coverage requirements. These will be submitted on a lot by lot basis as part of the Building Permit application process. 4(e) Lot areas for each lot and coverage calculations have not been submitted. There are a number of waivers requested regarding building and lot coverage. The City Planning Staff has indicated that it will seek conformance with the Southeast Quadrant requirements for lot and building coverage within each development area which the applicant will comply with. Mr. Brian Robertson Page 4 of 8 September 21, 2004 4(g) "Cut sheets for all proposed outdoor lighting" within the site have not been submitted. In particular, cut sheets for outdoor lighting for the school and the residences have not been submitted. A cut sheet for the proposed street lighting was included with the application. Since the school and large multi -family units are not a component of this application, there were no submittals made for these buildings and supporting sites. 4(h), (k), and (x) - Landscaping, screening and buffering plans have not been submitted. Rather, all that has been submitted so far is a landscaping design showing the location of street trees. This application primarily seeks approval for the development of the supporting infrastructure (roads, utilities, drainage). Since the school and large multi -family buildings will be reviewed under separate applications, the landscaping plans for these areas will be submitted at that time. 4(o) The location and design of all energy distribution facilities including electrical, gas and solar energy have not been submitted. The location of the electrical distribution duct banks has been shown on the Utility Plans. The gas line locations will be added once Vermont Gas Systems has signed off on the proposed locations. 4(r) The estimated cost of all site improvements has not been submitted. This will be submitted with the updated plans. SBZR § 15.08A(7) A preliminary design of any bridges or culverts which may be required has not been submitted, In particular, the Developer has not submitted the design for the culverts and bridge that it proposes for crossing waterways and wetlands. The Phase I design plans do not call for the crossing of the major wetland nor its associated watercourse, therefore no structures have been depicted at this time. SBZR § 15.08A(8) Temporary markers adequate to enable the Development Review Board to locate readily and appraise the basic layout in the field do not exist. These were planned to be added prior to the proposed site visit by the DRB. SBZR § 15.08(9) The list of waivers sought by the applicant appears nonsensical because it has not been updated to reflect recent bylaw amendments. For example, it refers to waivers in § 25.00 and in Table 25. The current bylaws end with Article 17 Mr. Brian Robertson Page 5of8 September 21, 2004 and do not contain a Table 25. This request has been amended. SBZR § 15.08A(11) The surveyor has not signed the survey. This can easily be corrected. 2. The Developer has so far failed to submit information necessary to consider the impact of the wetlands encroachments that it proposes. SBZR § 12.02 provides that such encroachments may be permitted "only in conjunction with the issuance of a Conditional Use Determination (CUD) by the Vermont Department of Environmental Conservation and positive findings by the DRB pursuant to the criteria in (3) below" as follows.. (a) The encroachment(s) will not adversely affect the ability of the property to carry or store flood waters adequately, (b) The encroachment(s) will not adversely affect the ability of the proposed stormwater treatment system to reduce sedimentation according to state standards.. (c) The impact of the encroachment(s) on the specific wetland functions and values identified in the field delineation and wetland report is minimized and/or offset by appropriate landscaping, stormwater treatment, stream buffering, and/or other mitigation measures. We interpret this language as requiring the applicant both to obtain a CUD determination before South Burlington can complete its review and to submit data allowing the Development Review Board to independently analyze each of the above criteria. The Developer has neither commenced the CUD process nor submitted an iota of data demonstrating compliance with the above standards. The applicant has appeared before the City's Natural Resources Committee and will provide any additional information the City requires in order for it to make its findings under SBZR § 12.02 (3). The applicant will be proceeding with a CUD application. The applicant concurs that the City DRB should condition any approval with the requirement that a CUD be granted by the State of Vermont. 3. The Developer has failed to submit any information concerning the impact of its proposed development on stormwater. Rather, the Developer improperly proposes that the "City rely upon the issuance of a Stormwater Discharge Permit from the State that the applicant has met its burden of proof relative to the requirements of this section." Mr. Brian Robertson Page 6 of 8 September 21, 2004 Such issuance, however, if and when it occurs, is merely "evidence of sufficient management of stormwater for purposes of satisfying State requirements." SBZR § 15.13F(1). The Development Review Board must still review state stormwater issues. Of course, the issuance of a state permit is not even evidence of satisfaction of municipal standards, which control if they are "more conservative." This information which is being developed for the State review process will be submitted with the updated Preliminary Plan documents. 4. The Developer has yet to submit sufficient information concerning grading and erosion controls. SBZR § 15.18A(2) requires the applicant to show that: Sufficient grading and erosion controls will be utilized during construction and after construction to prevent soil erosion and runoff from creating unhealthy or dangerous conditions on the subject property and adjacent properties. In making this finding, the DRB may rely on evidence that the project will be covered under the General Permit for Construction issued by the Vermont Department of Environmental Conservation. The application includes plans, narratives, specifications, inspection forms, a water quality monitoring program and four sheets of details in support of the minimization of erosion and controlling sediment on site (see Sheets C7.0 through C7.10). The applicant proposes to apply for and acquire an Individual Permit to Discharge Stormwater from Construction Sites from the State of Vermont and is willing to condition the project accordingly. The applicant proposes too much impervious surface to qualify for a general permit. Yet, the applicant submits no plan for controlling erosion for the property. SBZR § 16.03B provides As outlined above, this is an inaccurate statement. (1) The smallest practical area of land should be exposed at any one time during development. When land is exposed during development, the exposure should be kept to the shortest practical period of time. (2) Land shall not be left exposed during winter months. (3) Where necessary, temporary vegetation and/or mulching and structural measures shall be required by the Development Review Board to protect areas exposed during development. Mr. Brian Robertson Page 7 of 8 September 21, 2004 (4) Sediment basins (debris basins, desalting basins, or silt traps) shall be installed and maintained during development to remove sediment from run off water and from land undergoing development. (5) The permanent final vegetation and structures shall be installed as soon as practical in the subdivision. (6) Adequate and permanent measures shall be taken at culvert outfalls to minimize or prevent erosion and disruption of drainageway areas. The applicant submits no plans showing its compliance with these regulations. Please see above. We believe that the notice provision of the Permit Reform Bill now applies. "Said hearing [on the master plan and preliminary plat plan] shall be advertised and warned in accordance with this public notice provision of the Vermont Planning Development Act". SBZR § 15.08 B(1). Those provisions require "notification" to be accompanied by information that clearly informs the recipient where additional information may be obtained and that participation in the local proceeding is a prerequisite to the right to take any subsequent appeal". 24 V.S.A. § 4464. Such notification must be given seven days before the hearing for preliminary plat approval. Of course, at least the project application must be completed at that time so that the notification accurately identifies where such application may be obtained. We believe the so-called Master Plan and Phase 1 Applications submitted by South Village Communities, LLC are deficient. South Burlington Zoning Regulations (SBZR 1.15.08B(1)) provides that a public hearing shall be held by the Development Review Board after submission of all requested information. Consistent with this restriction, so that we can all have a fair and complete opportunity to understand this project, we ask the South Burlington Development Review Board not to review South Village's Master Plan and Phase 1 applications until at least these deficiencies are resolved. With the understanding that this application would be heard under at least two if not three public hearings, it is our opinion that all of the requisite information will be available for review and public comment during this process. Mr. Brian Robertson Page 8of8 September 21, 2004 This completes our responses to the issues raised by Mr. Anderson. If you should have any questions, please feel free to contact me at 985-2323. Respectfully, r David S. Marshall, `P. E. Project Engineer 1500711 \\Dave\c\1 Let\01243\ResponsestoBurakAnderson.wpd PAUL FRANK COLLINS P.C. September 23, 2004 Mr. Brian Robertson, Planning Associate City of South Burlington 575 Dorset Street South Burlington, VT 05403 Re: South Village PRD Calkins/South Village Communities, LLC Master Plan and Phase I Preliminary Plan Application Dear Mr. Robertson: Mark G. Hall (VT) mhall@PFC/aw.com South Village proposes to create an innovative neighborhood residential development on the fallow Calkins Farm off Spear Street in South Burlington. This neighborhood development will include a school, a working organic farm, and will be built to a pedestrian scale. South Village currently seeks approval of its master plan and preliminary plat approval of the two development pods nearest to Spear Street. Apart from understandable questions about traffic from those who live on Spear Street, which will be fully addressed during the hearing process, there has been no objection to pods 1 and 2. Indeed, even the harshest critic of the project, Mr. Vallee, indicated that pods 1 and 2 represent a good project. His objections relate only to development of pod 3, nearest to his home. As was evident at the sketch plan hearing, Mr. Vallee and his attorney, Mr. Anderson, appear to be using a strategy to disrupt the South Village hearings by whatever means possible, including raising legally unjustifiable procedural arguments, interrupting the applicant, ignoring the direction of the acting Chairperson of the Development Review Board ("DRB"), and perhaps sending out misleading communications to the neighborhood.' South Village is confident that the DRB will do everything in its power to protect the integrity of the process, although we expect that attempts to derail the process undoubtedly will continue. To help move the process forward, clarify issues, and keep the project as transparent as possible, South Village submits the following executive summary of what it expects will be the key non - traffic related issues.2 Specifically, the summary will address: 1) traffic, 2) wetlands, 3) wildlife, and 4) procedural issues. Some of the information will be duplicative of other submissions, but it should nonetheless be helpful to keep matters on track in light of the recent objections. This summary is being forwarded to all the people on the notification list and/or those who appeared at the hearing and gave a mailing address. People interested in additional 1 Dave Marshall, P.E. responded point by point to Mr. Anderson latest letter in detail in his correspondence dated September 21, 2004. 2 Traffic and circulation will be presented in detail at the September 28, 2004 DRB hearing. ATTORNEYS AT LAW I www.PFC/aw.com One Church Street P.O. Box 1307 Burlington, VT 05402-1307 phone 802.658.2311 fax 802.658.0042 A Member of TerraLex@ The Worldwide Network of Independent Law Firms Mr. Brian Robertson, Planning Associate September 23, 2004 Page 2 information are encouraged to visit our website at www.southvillage.com.3 As the process goes forward, South Village strongly encourages anyone with questions to look at the information contained on the South Village website and to call South Village representatives with any questions or comments. We hope to maintain an open dialogue with all interested parties throughout the project. Project Overview South Village will be situated on the Calkins property at the intersection of Spear Street and Allen Road. The property is an old farm that has fallen into disuse. South Village is designed to build neighborhood residential communities utilizing the ecologically and community based approach of the New Urbanist movement. South Village uses the pre-war pedestrian -oriented neighborhood design, complete with a working farm and a school. This design philosophy enhances a sense of community, while protecting important community resources and interests. The project features compact settlement patterns of development to create a walkable community with safer streets and common meetings places. Streets are narrowed and move in a non linear design to slow traffic while retaining connectivity among neighborhoods. A large portion of South Village will be left as open space and will be reinvigorated, and will include parks, commons, greens and pedestrian courtyards, bikeways and walking trails. The project will contain approximately 343 housing units consisting of detached and attached homes, including townhouses, condominiums (stacked flats), and "cottage" homes. A portion of the homes will be set aside as affordable work -force family -oriented housing targeted for those who may not be able to afford the ever appreciating market rate housing in South Burlington. To further enhance the sense of community, South Village will serve as the site for a private secondary school whose mission and curriculum will be oriented to the residents of the community. Through its innovative design, South Village will help to reinvigorate, preserve and protect the natural resources and habitat of the project site. A substantial portion of the site, approximately 40 acres, will be devoted to a community -supported organic farm managed by the Intervale Foundation. Additionally, much of the 41 acres of wetlands on the site will be undisturbed. Where disturbance of a wetland is unavoidable, innovative preservation and restoration techniques will be utilized to mitigate the disturbance. In addition to ecological preservation and protection, a substantial ecological restoration initiative will be undertaken by one of North America's leading ecological restoration firms as part of the development process. The goal of this restoration initiative is to restore native plant species to achieve the level of ecological diversity that was found on the site prior to agricultural uses. The restored vegetation system will help attract and encourage wildlife uses on the project site. 3 South Village's architects, Looney, Ricks, Kiss, is a national design, architect, and planning firm that has won numerous design awards for its innovative communities throughout the United States. Their work can be seen at wwwArk_com_ Mr. Brian Robertson, Planning Associate September 23, 2004 Page 3 South Village is one of only a few projects certified by the Vermont Smart Growth Collaborative. This collaborative of nine of Vermont's environmental and community advocacy groups endorsed South Village based upon the values it promotes and the needs it meets. We view this endorsement as a signal that the South Village model is consistent with the values and interests of the residents of Vermont and particularly with values and interests of the residents of South Burlington. It is anticipated that the project will be built out over approximately six years, which will mitigate any disturbance to existing residents and neighbors. I. Traffic A full description of the traffic plan is not possible in a summary. In general, the primary point of access will be at the signalized intersection of Spear Street and Allen Road. Two other points of entry are expected on Spear Street and the City of South Burlington has requested a continuation of Midland Avenue into the adjacent Dorset Farms development. Importantly, the internal circulation (along with Midland Avenue) is being designed to slow and disperse traffic, so as not to act as a high speed connector street between Spear and Dorset street. The traffic concept is to use narrow streets, slower speeds, and alternative routes to maintain and encourage connectivity between neighborhoods while at the same time discouraging pass - through, commuter traffic. South Village will be seeking waivers of street widths (including at Midland Avenue) to reduce speeds and minimize impacts on wetlands and other environmental resources. It is anticipated that, with the traffic improvements, the project will help alleviate some of the neighbor's current concerns about their access to Spear Street. We, of course, encourage the neighbors' questions and comments both at the hearing and to our staff at any time. II. Wetlands A. Wetland Functions. The wetlands at the South Village ("Calkins Farm") site, as delineated on the site plan, are extensive. The easternmost wetland, which is a forested swamp, is separated from the others and is essentially a separate system. It is characterized by a peaty soil and dense thickets of shrubs, and the ground surface has a pronounced hummock/hollow configuration, evidence that it was never drained or farmed. The other wetlands are developed on clay soils and have seen intensive agricultural use in the past. With the abandonment of agriculture, the wetlands have become re-established. They occur mostly on the broad valley floor of a headwater of Monroe Brook, with some fingers of wetland extending upslope along side -valleys, and also with some on more or less level, elevated terrain both along the southern edge and along Spear Street. Mr. Brian Robertson, Planning Associate September 23, 2004 Page 4 The project, as shown in the sketch plan, will: 1) avoid the forested wetland on the east edge of the property entirely, 2) mostly avoid the main central wetlands, except for roadway crossings at the narrowest points, and 3) convert wetlands along Spear Street to agricultural use (but the topography of these wetlands will not be changed, so they could in the future 'revert' to natural conditions). The main impacts to wetlands areas will come from the proposed roadway crossings, which will include the connector road to Dorset Farms, a crossing of the main wetland and stream at a narrow point, and a second crossing of the stream in the buffer zone just downstream of the wetland edge. According to Art Gilman of William D. Countryman, Environmental Assessment & Planning, the wetlands have a number of functions and values, including flood storage, water quality maintenance, and wildlife, outlined as follows in accordance with Vermont Department of Wildlife Wetland Rules: 1) Storm water storage. The storage capacity of the wetland is independent of the uplands, and depends only on the characteristics of the wetlands themselves; with minimal intrusion (i.e., the road crossings), this will be minimally impacted; the Ridge community (pod 3) would have no impact. 2) Water quality through trapping of sediments, toxicants, and pathogens. With the storm water treatment in place, there should be little or no additional input and no effect on water quality from the Ridge Development. 3) Water quality through uptake of nutrients. Again, the main wetland is dominated by lake sedge, which is very well suited to uptake of nutrients so there should be no impact. 4) Fisheries. The wetland is not significant for fisheries. 5) Hydrophilic vegetation. The forested swamp along the eastern edge of the property is likely a significant area for hydrophilic vegetation as a community, but no development is proposed within it or within 50' of it. The eastern arm of the central wetland is also significant because it contains a rare bedstraw species. Because this species occurs in wetlands, not in the upland, there should not be an impact. 6) Wildlife Habitat. There are numerous species, not all of them wetland - dependent, and they are scattered throughout the project, but primarily in the wetlands, the shrubby areas, and the forest. There is not any particularly heavy use along the wetland fringes (i.e., 'buffer zones'). There is concentrated use at the manmade pond, which will be retained. The species observed are mostly well adapted to the mixed landscape, not wild areas, and/or have small ranges and are able to find homes in localized areas within the property. The ridge area does not seem to have any particularly abundant resources or 'strong attractants' to wildlife use, although the shrubby areas Mr. Brian Robertson, Planning Associate September 23, 2004 Page 5 provide habitat for cottontail rabbits, woodcocks, and a number of songbirds. The forested area at present seems to have relatively few resources except cover. 7) Recreation. As generally construed, recreational uses pertain to uses for fishing, hunting, canoeing, hiking, etc. This wetland would not be significant for this function. The existing trails generally skirt the wetland and would likely be present, even if the wetland were not present. 8) Education. As generally construed, this wetland would not be significant for this function. It is not near schools, is poorly accessible to the general public, and has not been noted as a significant natural area. 9) Erosion control. As generally construed, this wetland would not be significant for this function, as it does not have any obvious erosive forces such as steep -gradient streams or waves. The wetlands per se are not as rich as they might be from a wildlife perspective, due to the general lack of permanent open water and because the stream is so small and seasonal. A scenario with more permanent open water, or a larger and perennial stream, would be more conducive to wetland -dependent wildlife than the situation that now exists. Also, the smaller wetland areas and fingers of wetland extending away from the main central wetland, under such a scenario, would become less important than the central area. Still, the importance of wetlands relates primarily to wildlife. With respect to the wetlands wildlife issues, there is no noticeable corridor or connectivity to adjacent off site habitats in any meaningful sense. However, the wetlands may provide some connectivity and interaction between different types of on -site habitats. They also likely provide home ranges for some species. The project provides for such connectivity along the easterly branch of the central wetland, has the eastern and central wetlands essentially untouched, and provides a relatively large block of upland and mixed habitat in the entire northeast sector of the property, and will assure that disturbances associated with roads on the southeastern border of the property will incorporate design features that favor wildlife movements. B. Wetland Delineation Issues. Attorney Anderson makes vague reference to alleged disputes over wetlands delineations. In reality, the wetlands have been reviewed by South Village's consultant, Mr. Vallee, his consultant, and April Moulart of the Agency of Natural Resources, and Mika Adams of the Army Corps of Engineers. A very few points of contention still exist, which would be expected on this type of site and given the magnitude of advocacy undertaken by Mr. Vallee. But, in reality none of the disputed areas (or their buffers) are actually impacted by the project. We submit that there are no further outstanding wetlands issues and the project is in fact an excellent example of achieving wetlands conservation while allowing necessary housing growth in a thoughtful manner. Mr. Brian Robertson, Planning Associate September 23, 2004 Page 6 D. Conclusions on Wetlands. The site contains extensive wetlands. The wetland functions are limited given the nature of the property as an old farm, but they undoubtedly provide for on -site diversity for wildlife and related functions. South Village largely avoids the wetlands completely, by utilizing almost all of the wetland areas to augment the retained open spaces. Accordingly, the wetland considerations for this project are minor. The only anticipated impacts related to a few road crossings, which will be made at the narrowest possible points, subject to state and local review and approval. III. Wildlife The design of South Village was based on mapping and ecological appraisal of wetland and upland communities, surveys of resident wildlife, and expert assessment of wildlife habitat. The property comprises a mix of upland fields, emergent wetlands, regenerating pine forests, young hardwood forests, and a unique forested wetland. Such diverse land cover would be expected to support a diverse community of plant and wildlife species. However, most of the property is in the early stages of recovering from agricultural uses —grazing and tilling —and supports a plant community that is dominated by invasive exotic species and forests with low structural diversity. The principal land management objective for South Village is to restore and enhance the ecological integrity of the land that surrounds and supports the village environment. Field surveys for wildlife were conducted systematically from January -July 2002 to document use of the property by mammals and birds. Tracks were detected for 13 species of wild mammals. Eastern cottontail, red fox and coyote tracks were observed most consistently. Several common species of small mammals also were observed on the site. White-tailed deer tracks were not found regularly throughout the winter, but their tracks were common and widespread in late winter and early spring. Fifty-seven species of birds were detected on the site. Most of these were common species that one would expect to see in the suburban landscape of South Burlington. The acreage of the South Village property has become isolated from some of the other undeveloped parcels in the vicinity. The west boundary of South Village abuts busy Spear Street and no significant movement of mammals was evident to the west of the property. To the northwest, the boundary is adjacent to some small fallow fields that mix with residential properties. The northeastern boundary, however, blends into a large patch of mature forest that extends onto adjacent properties and likely serves as a reservoir for many of the wildlife species detected on the South Village property. Indeed, most mammal tracks were found in this northeastern quadrant of the property. North of this forested area is now a large golf course and surrounding residential development, so wildlife movements in this direction are quite limited. The southern boundary of South Village abuts some fallow fields, residential property, and wetlands. This open land extends for about 2500 feet before intersecting Barstow Road. The Mr. Brian Robertson, Planning Associate September 23, 2004 Page 7 South Village design is sensitive to maintenance of habitat connectivity in this region, although there was no evidence from mammal tracking that significant wildlife movements occur across the southern property boundary. Wetlands do cross this boundary, however, and a road is proposed in this area, so wetland -dependent wildlife will be considered in project design. A unique aspect of the proposal for South Village is an ecological restoration plan that is designed to increase plant community diversity, stabilize soils, improve wildlife habitat, reduce impacts from past agricultural practices, and reduce the quantity and increase the quality of stormwater leaving the property. Restoration of native plant species will restore functional communities and improve habitats for wildlife. Restoring plant communities in the central wetland, surrounding grasslands, and young pine forests represents a significant investment in the ecological resources of the property. IV. Procedural Issues On Mr. Vallees's behalf, Attorney Anderson complained about procedural issues in a September 7, 2004 letter. He subsequently filed a notice of appeal of the sketch plan hearing essential claiming alleged defects in the notice to the public at large. Dave Marshall, P.E. of Civil Engineering Associates, responded point -by -point to the letter in September 21, 2004, and some further legal response is provided herein. A. Notice of Sketch Was Complete. Attorney Anderson suggests that our client, South Village failed to meet the "new" statutory notice requirements contained in the "Permit Reform Bill." He specifically suggests that our client failed to meet the requirements of 24 V.S.A. §4464, as amended by the Permit Reform Bill. However, Attorney Anderson fails to recognize that the notice requirements of 24 V.S.A. §4464 are not yet in effect. Pursuant to Section 119 of the Permit Reform Bill, the amended version of 24 V.S.A. §4464 does not take effect until September 1, 2005. Until that date, the current version of 24 V.S.A. §4464 remains in effect, and the current version lacks a notice requirement. Even if Attorney Anderson is correct in his assumption that 24 V.S.A. §4464 is effective, his argument still fails. As I stated in my August 17th letter, to the extent that the newly enacted 24 V.S.A. §4464(a) requires notice to Attorney Anderson's clients, it conflicts with the procedures set forth in the ordinance. Pursuant to 24 V.S.A. §4481, as amended by the Permit Reform Bill, if an ordinance procedure and the new statute conflict, the ordinance controls through September 1, 2005. See 24 V.S.A. §4481. Accordingly, the provisions of Section 4464 simply do not apply to this proceeding because it is not required by the ordinance. Moreover, even if the notice of 4464(a) procedures did apply, there is no question that Attorney Anderson and his client received actual notice. Therefore, Attorney Anderson's complaint about a lack of proper notice fails on its merits. Mr. Brian Robertson, Planning Associate September 23, 2004 Page 8 B. Premature Appeal The DRB may be aware that Mr. Vallee filed a recent appeal of the sketch plan minutes. The appeal is premature and does not affect this process for a variety reasons. First, there is no decision made in sketch plan, so there is no decision to appeal. As the DRB knows, the sketch plan process is simply an overview of the project subject to Vermont Open Meeting's laws. It is a meeting to discuss the project in which no decisions are made. Second, even if there was something to appeal from sketch plan, any appeal taken prior to a final decision on a permit application is interlocutory (which is a legal term for appeals of preliminary orders and interim decisions). The Vermont Planning and Development Act does not permit interlocutory appeals, so there is recognized no procedure for Attorney Anderson's action. See V.R. C.P. 76(e) (providing for appeals from "final decisions. '). If there were such an appeal, zoning cases would yo-yo through the process in the most uneconomical fashion possible. Attorney Anderson himself admits in the cover letter to his appeal to the Environmental Court that the appeal could be considered premature, and that he is simply preserving an issue for consideration. Attorney Anderson may make some claim that his appeal removes jurisdiction of the DRB to rule on the application; however, the Vermont Supreme Court has been clear that premature appeals do not affect the jurisdiction of the DRB. Instead, the appeal is treated as filed on the day the final decision is entered or the 60 days necessary for "deemed approval" have run. See In re White, 155 Vt. 612 (1991). In the meantime, jurisdiction stays with the lower tribunal. The mere filing of the premature notice does not remove jurisdiction from the lower tribunal. See id.; State v. Kennison, 135 Vt. 238. C. A Developer Is Not Required to Obtain CUD Requirements for Preliminary Plat. Typical of his legal arguments throughout this process, Attorney Anderson wrongly claims that South Village needs to obtain a Conditional Use Determination ("CUD") from the Vermont Department of Environmental Conservation before the Board can complete its review of the project. This is flat wrong. The South Burlington Land Development Regulations ("SBLDR") do not require an applicant to obtain a CUD prior to the Board's approval. In contrast, SBLDR § 12.02 simply requires an applicant to obtain a CUD before encroaching into Class II wetlands, which would be true even if no local permit or review were required. If a CUD is required, and our client fails to obtain the CUD before encroaching into a Class II wetland, any approval granted by the Board would be considered conditional, and encroachment into a Class II wetland at the site would be prohibited by both the Vermont Wetlands Rules and SBLDR § 12.02. Therefore, it is irrelevant when our client obtains the CUD, so long as it is obtained prior to its actual "encroaching" into a Class II wetland at the site. South Village hopes this executive summary is helpful. If you have additional questions, do not hesitate to contact me. Mr. Brian Robertson, Planning Associate September 23, 2004 Page 9 South Village hopes this executive summary is helpful. If you have additional questions, do not hesitate to contact me. Cordially yours, PAUL FRANK + COLLINS P.C. Mark G. Hall cc: Jon T. Anderson, Esq. Notification List 387107 v2:3264-00014 The Retrovest Companies B U I L D E R S& D E V E L O P E R S Via Hand Delivery September 23, 2004 Brian Robertson, Associate Planner South Burlington Design Review Board 575 Dorset Street Burlington, VT 05403 Dear Brian: For the tile, attached please find the list of people that were mailed a copy of Mark Hall's letter of September 23, 2004, referenced as the cc: Notification List. It is comprised of the abutting neighbors to the project per the list submitted with our application, the list of folks who signed in at the Sept. 7, 2004 meeting, and the list of all Dorset Farms Residents that was provided by Dan Wetzel. We did not include it with the copies of the letters to the cc's noted. Sincerely, Michelle Holgate 70 South Winooski Avenue Burlington, VT 05401-3830 802-863-8323 800-679-1929 F 802-863-1339 www.retrovest.com Mr. Jon t. Anderson, Esq. Burak, Anderson & Mellon, PLC 30 Main St. P.O. Box 787 Burlington, VT 05402-0787 ,LIST O� DORStT f 4- RMS eES1p,,1VCLS . ,5uv/p' Leo! by '`Mar ue le- wefzel. /V C'ct!/�i�Is P2ive- ��.��/off JODY T & ROXANNE A MCDONALD Regarding Property located at: 10 BOWER ST 10 BOWER ST S BURLINGTON, VT 05403 RICHARD C & DARLENE J BURKE Regarding Property located at: 12 BOWER ST 12 BOWER ST S BURLINGTON, VT 05403 JAMES E & SHELLEY J PARISEAU Regarding Property located at: 15 BOWER ST 15 BOWER ST S BURLINGTON, VT 05403 RANDALL R CHARLEBOIS Regarding Property located at: 17 BOWER ST S BURLINGTON, VT 05403 & PAOLA M CHARLEBOIS 17 BOWER ST BRIAN C & NANCY H KENNEY Regarding Property located at: 19 BOWER ST 19 BOWER ST S BURLINGTON, VT 05403 PETER GERALD & LINDA P MICKEL Regarding Property located at: 21 BOWER ST 21 BOWER ST S BURLINGTON, VT 05403 JAWS VIAPAINA & MARY M VIAPAINA Regarding Property located at: 23 BOWER ST 23 BOWER ST S BURLINGTON, VT 05403 LEO P & VIRGINIA M O'REILLY Regarding Property located at: I 1 BOWER ST I 1 BOWER ST S BURLINGTON, VT 05403 PAUL CRAWFORD BYERS & ANNE M O'NIELL Regarding Property located at: 14 BOWER ST 14 BOWER ST S BURLINGTON, VT 05403 JUI-CHU LEE & SITYUAN-JU CHIOU Regarding Property located at: 16 BOWER ST 16 BOWER ST S BURLINGTON, VT 05403 JASON B COOPER & LAURA S COOPER Regarding Property located at: 18 BOWER ST 18 BOWER ST S BURLINGTON, VT 05403 Q & CINDY T LE VUONG Regarding Property located at: 20 BOWER ST 20 BOWER ST S BURLINGTON, VT 05403 CHARLES L BOMBARD & WENDY PINDER BOMBARD Regarding Property located at: 22 BOWER ST 22 BOWER ST S BURLINGTON, VT 05403 ANDREW P & ANGELIA J HAAG Regarding Property located at: 24 BOWER ST 24 BOWER ST S BURLINGTON, VT 05403 WILLIAM F & MARY C STEARNS Regarding Property located at: 25 BOWER ST 25 BOWER ST S BURLINGTON, VT 05403 STEPHEN W LANE & SUZANNE G TENENBAUM Regarding Property located at: 27 BOWER ST 27 BOWER ST S BURLINGTON, VT 05403 MICHAEL P & MELISSA A MALONEY Regarding Property located at: 29 BOWER ST 29 BOWER ST S BURLINGTON, VT 05403 ZHIHUA PENG & MINFANG GONG Regarding Property located at: 31 BOWER ST 31 BOWER ST S BURLINGTON, VT 05403 ERIC M KNUDSEN & KELLY B KNUDSEN Regarding Property located at: 33 BOWER ST 33 BOWER ST S BURLINGTON, VT 05403 MICHAEL D & SANDRA R BRADSHAW Regarding Property located at: 35 BOWER ST 35 BOWER ST S BURLINGTON, VT 05403 JENN-TSAI HUANG & YI-YU PAN Regarding Property located at: 37 BOWER ST 37 BOWER ST S BURLINGTON, VT 05403 MARC J & PAULA J COURCY Regarding Property located at: 26 BOWER ST 26 BOWER ST S BURLINGTON, VT 05403 HARRIET AUSTIN Regarding Property located at: 28 BOWER ST 28 BOWER ST S BURLINGTON, VT 05403 GREGORY G & RACHEL L GOYETTE Regarding Property located at: 30 BOWER ST 30 BOWER ST S BURLINGTON, VT 05403 FRANCESCO & ROSEANN DEL RE Regarding Property located at: 32 BOWER ST PSC 59 BOX 22 APO, AE 09624 STEVEN J & KARI A PLOOF Regarding Property located at: 34 BOWER ST 34 BOWER ST S BURLINGTON, VT 05403 J MORGAN GROVE & JENNIFER C JENKINS Regarding Property located at: 36 BOWER ST 36 BOWER ST S BURLINGTON, VT 05403 ERWIN B COHEN & DANA M FARR Regarding Property located at: 39 BOWER ST 39 BOWER ST S BURLINGTON, VT 05403 ROBERT J & AMY K KAKALEC Regarding Property located at: 41 BOWER ST 41 BOWER ST S BURLINGTON, VT 05403 KENNETH P CAMYRE Regarding Property located at: PO BOX 501 WILLIAMSBURG, MA 01096 DAVID M & LINDA S RITNER Regarding Property located at: 43 BOWER ST 43 BOWER ST S BURLINGTON, VT 05403 ROBERT R & CHRISTINE E GAUTHIER 45 BOWER ST Regarding Property located at: 47 BOWER ST 47 BOWER ST S BURLINGTON, VT 05403 JOSEPH SANPETRINO & JANE M SANPETRINO Regarding Property located at: 49 BOWER ST 49 BOWER ST S BURLINGTON, VT 05403 SHUNHUA THOMAS CHANG & YAHSIASUNNI WANG Regarding Property located at: 53 BOWER ST 53 BOWER ST S BURLINGTON, VT 05403 JAMES S & DEBRA R HEALD Regarding Property located at: 57 BOWER ST 57 BOWER ST S BURLINGTON, VT 05403 DENNIS & SANDRA L GARON Regarding Property located at: 61 BOWER ST 61 BOWER ST S BURLINGTON, VT 05403 KYLE N & SUSAN F CHURCH Regarding Property located at: 65 BOWER ST 65 BOWER ST S BURLINGTON, VT 05403 KATHIE R DESAUTELS Regarding Property located at: 51 BOWER ST 51 BOWER ST S BURLINGTON, VT 05403 JOHN A & CATHERINE D MILNE Regarding Property located at: 55 BOWER ST 55 BOWER ST S BURLINGTON, VT 05403 JOHN A ARUZZA & ROBIN M ARUZZA Regarding Property located at: 59 BOWER ST 59 BOWER ST S BURLINGTON, VT 05403 CRAIG A SMITH & YURIKO SMITH Regarding Property located at: 63 BOWER ST 63 BOWER ST S BURLINGTON, VT 05403 PETER S & GAYLE P CONKLIN Regarding Property located at: 67 BOWER ST 67 BOWER ST S BURLINGTON, VT 05403 DONALD H & LISA A ANGWIN Regarding Property located at: 73 BOWER ST 73 BOWER ST S BURLINGTON, VT 05403 PASQUALE & DEBORAH K DISTEFANO Regarding Property located at: 75 BOWER ST 75 BOWER ST S BURLINGTON, VT 05403 JARED A & KAREN A LARROW Regarding Property located at: 77 BOWER ST 77 BOWER ST S BURLINGTON, VT 05403 P JAMES ROBERT & CHRISTINA M ROBERT Regarding Property located at: 79 BOWER ST 79 BOWER ST S BURLINGTON, VT 05403 PIERRE Y HEROUX & SUSAN MABEY Regarding Property located at: 82 BOWER ST 82 BOWER ST S BURLINGTON, VT 05403 KHAIMOOK PUONYRAHARN Regarding Property located at: 1 CABOT CT 1 CABOT COURT S BURLINGTON, VT 05403 MBL ASSOCIATES Regarding Property located at: 3 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 MITCHEL CYPES & LYNAN MOY Regarding Property located at: 74 BOWER ST 74 BOWER ST S BURLINGTON, VT 05403 AHMED & ARWA GINAWI Regarding Property located at: 76 BOWER ST 76 BOWER ST S BURLINGTON, VT 05403 PATRICK M & MARY ELLEN FORGIONE Regarding Property located at: 78 BOWER ST 78 BOWER ST S BURLINGTON, VT 05403 JOHN T & SANDRA L CARDAMONE Regarding Property located at: 80 BOWER ST 80 BOWER ST S BURLINGTON, VT 05403 JOSEPH & DIANE CHENEY Regarding Property located at: 84 BOWER ST 84 BOWER ST S BURLINGTON, VT 05403 JOHN M & SHERRY B CUSHMAN Regarding Property located at: 2 CABOT CT 2 CABOT COURT S BURLINGTON, VT 05403 MBL ASSOCIATES Regarding Property located at: 4 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 ZHENHUA ZHOU & MIN GU Regarding Property located at: 5 CABOT CT 5 CABOT COURT S BURLINGTON, VT 05403 HENRY L & MINH PRAM VO Regarding Property located at: 7 CABOT CT 7 CABOT COURT S BURLINGTON, VT 05403 DANIEL W & JODIE W CHANT Regarding Property located at: 9 CABOT CT 9 CABOT COURT S BURLINGTON, VT 05403 KEITH D & ELIZA B SEVERY Regarding Property located at: 11 CABOT CT 11 CABOT COURT S BURLINGTON, VT 05403 SUREN & VASANTHI VALOO Regarding Property located at: 14 CABOT CT 14 CABOT COURT S BURLINGTON, VT 05403 JEFFREY J & ROBIN B SHEPERD Regarding Property located at: 16 CABOT CT 16 CABOT COURT S BURLINGTON, VT 05403 CHRISTOPHER L & LOUISE E DEGUISE Regarding Property located at: 18 CABOT CT 18 CABOT COURT S BURLINGTON, VT 05403 MBL ASSOCIATES Regarding Property located at: 6 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 SEAN S & EILEEN M MALONEY Regarding Property located at: 8 CABOT CT 8 CABOT COURT S BURLINGTON, VT 05403 JAMES J & DENISE G OROURKE Regarding Property located at: 10 CABOT CT 10 CABOT COURT S BURLINGTON, VT 05403 HANSHENG TANG & ZHILING PENG Regarding Property located at: 12 CABOT CT 12 CABOT COURT S BURLINGTON, VT 05403 GREGORY L REYNOLDS & DORIS S WING Regarding Property located at: 15 CABOT CT 15 CABOT COURT S BURLINGTON, VT 05403 MARK D & KRISTIN L MAGNANT Regarding Property located at: 17 CABOT CT 17 CABOT COURT S BURLINGTON, VT 05403 SCOTT M & MELISSA A MILLS Regarding Property located at: 19 CABOT CT 19 CABOT COURT S BURLINGTON, VT 05403 DANNY & ELAINE J HUANG JEFFREY M & ANN-MARIE BERGERON Regarding Property located at: 20 CABOT CT Regarding Property located at: 21 CABOT CT 20 CABOT COURT 21 CABOT COURT S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 DAEWON & JOOYEON LEE BRIAN & RENEE WEHRLE Regarding Property located at: 23 CABOT CT Regarding Property located at: 24 CABOT CT 23 CABOT COURT 24 CABOT COURT S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 MICHAEL YONG HOCK LEE & ALISON OI LAN CHEANG MARTINJ & COLLEEN F HOGAN Regarding Property located at: 25 CABOT CT Regarding Property located at: 26 CABOT CT 25 CABOT COURT 26 CABOT COURT S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 MBL ASSOCIATES PETER B & JILL M KNOX Regarding Property located at: 27 CABOT CT Regarding Property located at: 28 CABOT CT 25 PINECREST DR 28 CABOT COURT ESSEX JCT, VT 05452 S BURLINGTON, VT 05403 MBL ASSOCIATES PAUL D & SANDRA A OGILVIE Regarding Property located at: 29 CABOT CT Regarding Property located at: 30 CABOT CT 25 PINECREST DR 30 CABOT COURT ESSEX JCT, VT 05452 S BURLINGTON, VT 05403 MBL ASSOCIATES BRETT H BARTLETT Regarding Property located at: 31 CABOT CT Regarding Property located at: 32 CABOT CT 25 PINECREST DR 32 CABOT COURT ESSEX JCT, VT 05452 S BURLINGTON, VT 05403 MBL ASSOCIATES KEVIN R & AMY S MORRISSEY Regarding Property located at: 33 CABOT CT Regarding Property located at: 34 CABOT CT 25 PINECREST DR 34 CABOT COURT ESSEX JCT, VT 05452 S BURLINGTON, VT 05403 MUSTAP14A SLAMANI & RANIA EL-TAMIMI Regarding Property located at: 35 CABOT CT 35 CABOT COURT S BURLINGTON, VT 05403 MBL ASSOCIATES Regarding Property located at: 38 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 STEVEN EDWARD & LISA MARIE STURGIS Regarding Property located at: 42 CABOT CT 42 CABOT CT S BURLINGTON, VT 05403 THOMAS W & MARYELLEN E SCHAEFER Regarding Property located at: 48 CABOT CT 48 CABOT COURT S BURLINGTON, VT 05403 MBL ASSOCIATES Regarding Property located at: 1 CATKIN DR 25 PINECREST DR ESSEX JCT, VT 05452 MICHOLAS & JULIA MELLISH Regarding Property located at: 5 CATKIN DR 5 CATKIN DR S BURLINGTON, VT 05403 SUSAN C MCFAUL Regarding Property located at: 9 CATKIN DR 9 CATKIN DR S BURLINGTON, VT 05403 MBL ASSOCIATES Regarding Property located at: 36 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 MBL ASSOCIATES Regarding Property located at: 40 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 MBL ASSOCIATES Regarding Property located at: 46 CABOT CT 25 PINECREST DR ESSEX JCT, VT 05452 BRIAN C & CHRISTINE M SOWLE Regarding Property located at: 50 CABOT CT 50 CABOT COURT S BURLINGTON, VT 05403 WILLIAM & MARY ANN CARRIGAN Regarding Property located at: 3 CATKIN DR 3 CATKIN DR S BURLINGTON, VT 05403 CHRISTOPHER & PENNY TUDOR Regarding Property located at: 7 CATKIN DR 7 CATKIN DR S BURLINGTON, VT 05403 JACK R & ELIZABETH R SMITH Regarding Property located at: 11 CATKIN DR I I CATKIN DR S BURLINGTON, VT 05403 ZHANNA S & KARO AMO ARAKELYAN Regarding Property located at: 15 CATKIN DR 15 CATKIN DR S BURLINGTON, VT 05403 CRAIG M MONROE Regarding Property located at: 19 CATKIN DR 19 CATKIN DR S BURLINGTON, VT 05403 JOHN S CHARLAND Regarding Property located at: 95 CATKIN DR 95 CATKIN DR S BURLINGTON, VT 05403 CLAUDE & ELIZABETH BOURGEA Regarding Property located at: 99 CATKIN DR 99 CATKIN DR S BURLINGTON, VT 05403 DENNIS WELLS Regarding Property located at: 102 CATKIN DR 102 CATKIN DR S BURLINGTON, VT 05403 QING DONG Regarding Property located at: 104 CATKIN DR 104 CATKIN DR S BURLINGTON, VT 05403 ROBERT & PAULINE LAVALLEY Regarding Property located at: 106 CATKIN DR 106 CATKIN DR S BURLINGTON, VT 05403 BRIAN ERICKSON & LELLIE RICE ERICKSON Regarding Property located at: 17 CATKIN DR 17 CATKIN DR S BURLINGTON, VT 05403 TUSHAR & AMRITA DESAI Regarding Property located at: 21 CATKIN DR 21 CATKIN DR S BURLINGTON, VT 05403 JOHN R & SABELITA M GEORGE Regarding Property located at: 97 CATKIN DR 97 CATKIN DR S BURLINGTON, VT 05403 JEFFERY & ELIZABETH ROBBINS Regarding Property located at: 101 CATKIN DR 52 LAUREL HILL DR S BURLINGTON, VT 05403 RANDY & LISA 14ANLON Regarding Property located at: 103 CATKIN DR 103 CATKIN DR S BURLINGTON, VT 05403 DEBORAH MAPLE Regarding Property located at: 105 CATKIN DR 105 CATKIN DR S BURLINGTON, VT 05403 ISRAEL & TONI ANN MAYNARD Regarding Property located at: 107 CATKIN DR 107 CATKIN DR S BURLINGTON, VT 05403 MITCHELL & ERIN TSAI Regarding Property located at: 108 CATKIN DR 108 CATKIN DR S BURLINGTON, VT 05403 TODD A BARRETT & WANDA BARRETT Regarding Property located at: 110 CATKIN DR 110 CATKIN DR S BURLINGTON, VT 05403 MARTIN J & JUDITH L MARA Regarding Property located at: 112 CATKIN DR 112 CATKIN DR S BURLINGTON, VT 05403 MARTIN ST LOUIS & HEATHER ANNE CARAGOL Regarding Property located at: 114 CATKIN DR 114 CATKIN DR S BURLINGTON, VT 05403 ALLISON B LANZETTA Regarding Property located at: 116 CATKIN DR 116 CATKIN DR S BURLINGTON, VT 05403 WILLIAM J LAWLOR & MELISSA A LAWLOR Regarding Property located at: 118 CATKIN DR 118 CATKIN DR S BURLINGTON, VT 05403 PAUL D HARRIMAN JR Regarding Property located at: 120 CATKIN DR 120 CATKIN DR S BURLINGTON, VT 05403 ALAN W & SUSAN A LUKENS Regarding Property located at: 109 CATKIN DR 86 SPEAR ST CHARLOTTE, VT 05445 LILY HONORIS Regarding Property located at: I I I CATKIN DR I I I CATKIN DR S BURLINGTON, VT 05403 CHRISTOPHER GILLMAN & BROOKE HAWKINS Regarding Property located at: 113 CATKIN DR 113 CATKIN DR S BURLINGTON, VT 05403 GEORGE R & NANCY A MCKENZIE Regarding Property located at: 115 CATKIN DR 115 CATKIN DR S BURLINGTON, VT 05403 ARTI & GIRGA S SHUKLA Regarding Property located at: 117 CATKIN DR 117 CATKIN DR S BURLINGTON, VT 05403 WILLEM I & ALBERTINE A DEGROOT Regarding Property located at: 119 CATKIN DR 119 CATKIN DR S BURLINGTON, VT 05403 CHRISTOPHER C & NICOLE M ADAMS Regarding Property located at: 121 CATKIN DR 121 CATKIN DR S BURLINGTON, VT 05403 BYRON E & AMI J ADAMS Regarding Property located at: 122 CATKIN DR 122 CATKIN DR S BURLINGTON, VT 05403 SANGEETA & SRIRAM PERI Regarding Property located at: 124 CATKIN DR 124 CATKIN DR S BURLINGTON, VT 05403 TYLER J GOULD Regarding Property located at: 126 CATKIN DR 126 CATKIN DR S BURLINGTON, VT 05403 J KENT & MARY ANN RIFFLE & GINO RIFFLE Regarding Property located at: 130 CATKIN DR 130 CATKIN DR S BURLINGTON, VT 05403 JOHN J & BARBARA M BENOIT Regarding Property located at: 134 CATKIN DR 134 CATKIN DR S BURLINGTON, VT 05403 CHARLES MCMANUS & JUDITH MCMANUS Regarding Property located at: 138 CATKIN DR 138 CATKIN DR S BURLINGTON, VT 05403 JAY H MOORE & CAROL L MOORE Regarding Property located at: 142 CATKIN DR 142 CATKIN DR S BURLINGTON, VT 05403 JANICE M CROSS Regarding Property located at: 123 CATKIN DR 123 CATKIN DR S BURLINGTON, VT 05403 JOSEPH M & CYNTHIA COUSINO Regarding Property located at: 125 CATKIN DR 125 CATKIN DR S BURLINGTON, VT 05403 YOURI TRETIAKOV Regarding Property located at: 128 CATKIN DR 128 CATKIN DR S BURLINGTON, VT 05403 LANCE A LLEWELLYN Regarding Property located at: 132 CATKIN DR 132 CATKIN DR S BURLINGTON, VT 05403 LEE D & JULIE H ALLABEN Regarding Property located at: 136 CATKIN DR 136 CATKIN DR S BURLINGTON, VT 05403 JOANNE AJA Regarding Property located at: 140 CATKIN DR 140 CATKIN DR S BURLINGTON, VT 05403 MARILYN J DUNN Regarding Property located at: 144 CATKIN DR 144 CATKIN DR S BURLINGTON, VT 05403 JOSHUA L & LUIZA BLOOMBERG Regarding Property located at: 146 CATKIN DR 146 CATKIN DR S BURLINGTON, VT 05403 RANDY L & SHARON L RIGGS Regarding Property located at: 150 CATKIN DR 150 CATKIN DR S BURLINGTON, VT 05403 SALLY K WALKER Regarding Property located at: 154 CATKIN DR 154 CATKIN DR S BURLINGTON, VT 05403 DEVINDER & NITTI SACHDEVA Regarding Property located at: 181 CATKIN DR 181 CATKIN DR S BURLINGTON, VT 05403 ZINAIDA S & VAZGEN A AYDINYAN & NUNE AYDINYAN Regarding Property located at: 185 CATKIN DR 185 CATKIN DR S BURLINGTON, VT 05403 MARK R & DEBORAH D FAY Regarding Property located at: 188 CATKIN DR 188 CATKIN DR S BURLINGTON, VT 05403 KIRK H & NANCY S WEED Regarding Property located at: 190 CATKIN DR 190 CATKIN DR S BURLINGTON, VT 05403 ANDREW RADDANT Regarding Property located at: 148 CATKIN DR 148 CATKIN DR S BURLINGTON, VT 05403 PETER F MURPHY & CHIGEE J CLONINGER Regarding Property located at: 152 CATKIN DR 152 CATKIN DR S BURLINGTON, VT 05403 GREGG & MARGRET E MARTIN Regarding Property located at: 156 CATKIN DR 156 CATKIN DR S BURLINGTON, VT 05403 DANIEL & MARGUERITE WETZEL Regarding Property located at: 183 CATKIN DR 183 CATKIN DR S BURLINGTON, VT 05403 PHILIP & DARCY CARTER Regarding Property located at: 187 CATKIN DR 187 CATKIN DR S BURLINGTON, VT 05403 JEFFERY SCOTT PALMER & LISA REESE PALMER Regarding Property located at: 189 CATKIN DR 189 CATKIN DR S BURLINGTON, VT 05403 JOHN F III & RITIKA R PAUL Regarding Property located at: 191 CATKIN DR 191 CATKIN DR S BURLINGTON, VT 05403 SHANE & HOLLY DERIDDER Regarding Property located at: 192 CATKIN DR 192 CATKIN DR S BURLINGTON, VT 05403 BHAGWAT S & GITA MANGLA Regarding Property located at: 195 CATKIN DR 195 CATKIN DR S BURLINGTON, VT 05403 JAYENDRA & SONAL BHAGAT Regarding Property located at: 2 FLORAL DR 2 FLORAL ST S BURLINGTON, VT 05403 DONALD JR & LISA BRUCE Regarding Property located at: 5 FLORAL DR 5 FLORAL DR S BURLINGTON, VT 05403 ROBERT C ACKERMAN & KAREN SMOLSKIS ACKERMAN Regarding Property located at: 7 FLORAL DR 7 FLORAL DR S BURLINGTON, VT 05403 PHI X & HAU NGUYEN Regarding Property located at: 9 FLORAL DR 9 FLORAL DR S BURLINGTON, VT 05403 VIJAY DESAI & DIPITY DESAI Regarding Property located at: 1 I FLORAL DR 11 FLORAL ST S BURLINGTON, VT 05403 DIRK & DEBORAH H MAREK Regarding Property located at: 193 CATKIN DR 193 CATKIN DR S BURLINGTON, VT 05403 TIMOTHY & JENNIFER OWENS Regarding Property located at: 197 CATKIN DR 197 CATKIN DR S BURLINGTON, VT 05403 MATTHEW & CHRISTINA BROWN Regarding Property located at: 4 FLORAL DR 4 FLORAL DR S BURLINGTON, VT 05403 MICHAEL B HERSHBERG & NICOLE HERSHBERG Regarding Property located at: 6 FLORAL DR 6 FLORAL DR S BURLINGTON, VT 05403 RANDY & HOLLY SHELTRA Regarding Property located at: 8 FLORAL DR 8 FLORAL DR S BURLINGTON, VT 05403 BRYAN C & LORI T ARNOLD Regarding Property located at: 10 FLORAL DR 10 FLORAL DR S BURLINGTON, VT 05403 JAMES & SUE GEARS Regarding Property located at: 12 FLORAL DR 12 FLORAL ST S BURLINGTON, VT 05403 DAVID A & HOLLY R KEOUGH TERRI DEVEAULT Regarding Property located at: 15 FLORAL DR Regarding Property located at: 17 FLORAL DR 15 FLORAL DR 17 FLORAL DR S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 KAY & SUK-YIN MUI SHAWN S & SHERI A HILL Regarding Property located at: 19 FLORAL DR Regarding Property located at: 21 FLORAL DR 19 FLORAL DR 21 FLORAL DR S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 DAVID & LISA PURINTON ERIC M & MICHELE H MCCALLIG Regarding Property located at: 23 FLORAL DR Regarding Property located at: 25 FLORAL DR 23 FLORAL DR 25 FLORAL DR S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 DAVID C JU & ALISON ARMS ANTHONY & NANCY BIANCHI Regarding Property located at: 28 FLORAL DR Regarding Property located at: 29 FLORAL DR 28 FLORAL DR 29 FLORAL DR S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 HOWARD J JR & MARIA M MOODY MICHAEL R BOUVIER & MARY ELIZABETH BOUVIER Regarding Property located at: 30 FLORAL DR Regarding Property located at: 31 FLORAL DR 30 FLORAL DR 31 FLORAL DR S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 GREGORY J & SALLY A LEMIEUX STANLEY J & CAROLYN R PALLUTTO Regarding Property located at: 32 FLORAL DR Regarding Property located at: 33 FLORAL DR 32 FLORAL ST 33 FLORAL ST S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 DAVID J & NANCY D FARRELL BRIAN A TERHUNE & CAROLYN J TERHUNE Regarding Property located at: 34 FLORAL DR Regarding Property located at: 35 FLORAL DR 34 FLORAL ST 35 FLORAL ST S BURLINGTON, VT 05403 S BURLINGTON, VT 05403 EDWARD HOCKENBURY & STEPHANIE HOCKENBURY Regarding Property located at: 36 FLORAL DR 36 FLORAL DR S BURLINGTON, VT 05403 STANLEY JR & DIANE MCKINLEY Regarding Property located at: 38 FLORAL DR 38 FLORAL ST S BURLINGTON, VT 05403 THOMAS A & ANNE MARTIN Regarding Property located at: 40 FLORAL DR 40 FLORAL ST S BURLINGTON, VT 05403 GARY A & DEBRA R BOWERS Regarding Property located at: 42 FLORAL DR 42 FLORAL DR S BURLINGTON, VT 05403 MICHAEL J PASQUAL & MARGARET H TITUS Regarding Property located at: 44 FLORAL DR 44 FLORAL DR S BURLINGTON, VT 05403 GLEN D BRIGGS & JANET LEE JACKSON Regarding Property located at: 46 FLORAL DR 46 FLORAL DR S BURLINGTON, VT 05403 JASON J & LYNN M ZIZZA Regarding Property located at: 51 FLORAL DR 51 FLORAL DR S BURLINGTON, VT 05403 MATTHEW & BEVERLY BROOMHALL Regarding Property located at: 37 FLORAL DR 37 FLORAL ST S BURLINGTON, VT 05403 JOHN P & JESSICA L MACDONOUGH Regarding Property located at: 39 FLORAL DR 39 FLORAL DR S BURLINGTON, VT 05403 PHILIP & KRISTINE MAGNANT Regarding Property located at: 41 FLORAL DR 41 FLORAL DR S BURLINGTON, VT 05403 WINFIELD & CYNTHIA REICHARD Regarding Property located at: 43 FLORAL DR 43 FLORAL DR S BURLINGTON, VT 05403 MARTHA GIBBONS Regarding Property located at: 45 FLORAL DR 45 FLORAL ST S BURLINGTON, VT 05403 JEFFREY B & ANNEMARIE N ADAMS Regarding Property located at: 48 FLORAL DR 48 FLORAL ST S BURLINGTON, VT 05403 WILLIAM & SHIRLEY WOLFORD Regarding Property located at: 53 FLORAL DR 53 FLORAL DR S BURLINGTON, VT 05403 ABDELMONEM & SANAA ELHOSSEINY Regarding Property located at: 55 FLORAL DR 55 FLORAL DR S BURLINGTON, VT 05403 NANCY J HOWARD Regarding Property located at: 59 FLORAL DR 59 FLORAL DR S BURLINGTON, VT 05403 WILLIAM D EMBERLEY & KAREN L SNYDER Regarding Property located at: 63 FLORAL DR 63 FLORAL DR S BURLINGTON, VT 05403 ANDREW J KNIGHT Regarding Property located at: 67 FLORAL DR 67 FLORAL DR S BURLINGTON, VT 05403 ABIY AMBAYA & ALGANESH MICHAEL Regarding Property located at: 71 FLORAL DR 71 FLORAL DR S BURLINGTON, VT 05403 ERIN GEDDES Regarding Property located at: 75 FLORAL DR 75 FLORAL DR S BURLINGTON, VT 05403 JASON R TIBALLI Regarding Property located at: 79 FLORAL DR 79 FLORAL DR S BURLINGTON, VT 05403 RICHARD R GOLDSBOROUGH Regarding Property located at: 57 FLORAL DR 57 FLORAL DR S BURLINGTON, VT 05403 WILLIAM SCOTT SCHWENK & ROXANNE BOGART Regarding Property located at: 61 FLORAL DR 61 FLORAL DR S BURLINGTON, VT 05403 FRASER & TRACEY MACDONALD Regarding Property located at: 65 FLORAL DR 65 FLORAL DR S BURLINGTON, VT 05403 MARK ISSENMANN Regarding Property located at: 69 FLORAL DR 69 FLORAL DR S BURLINGTON, VT 05403 THOMAS P MILLER Regarding Property located at: 73 FLORAL DR 73 FLORAL DR S BURLINGTON, VT 05403 RAM & SAVITA BHATIA Regarding Property located at: 77 FLORAL DR 77 FLORAL DR S BURLINGTON, VT 05403 DANIEL W EVANS & SINYOUNG RA EVANS Regarding Property located at: 80 FLORAL DR 80 FLORAL DR S BURLINGTON, VT 05403 SCOTT M & LAURIE KLEIN WISOTSKY Regarding Property located at: 81 FLORAL DR 81 FLORAL DR S BURLINGTON, VT 05403 JEFFREY M & LYNN T CUNNINGHAM Regarding Property located at: 83 FLORAL DR 83 FLORAL DR S BURLINGTON, VT 05403 BENJAMIN & JUDITH MALLORY Regarding Property located at: 85 FLORAL DR 85 FLORAL DR S BURLINGTON, VT 05403 DOUGLAS & DIANE BUGBEE Regarding Property located at: 89 FLORAL DR 89 FLORAL DR S BURLINGTON, VT 05403 JAMES & SUSAN WISOWATY Regarding Property located at: 93 FLORAL DR 93 FLORAL DR S BURLINGTON, VT 05403 PATRICK M & JEANNE H KENNEDY Regarding Property located at: 82 FLORAL DR 82 FLORAL ST S BURLINGTON, VT 05403 SALLY A VOSBURGH Regarding Property located at: 84 FLORAL DR PO BOX 1201 WILLISTON, VT 05495 JEFFREY W & KATHLEEN FRACK Regarding Property located at: 87 FLORAL DR 87 FLORAL DR S BURLINGTON, VT 05403 ADEL & MARIANNE SADEK Regarding Property located at: 91 FLORAL DR 91 FLORAL DR S BURLINGTON, VT 05403 MAsrF-R APPLIC4710d 061- or- 4Yu77/A((, A1C1(-NBons William Stanley Harold & Eleanor Bensen Janet Farina 306 South Beach Road 1803 Spear Street 1807 Spear Street So. Burlington, VT 05403 So. Burlington, VT 05403 So. Burlington, VT 05403 Mary Pappas Donald & Lynn Cummings William & Ayse Floyd 1809 Spear Street 1811 Spear Street 1813 Spear Street So. Burlington, VT 05403 So. Burlington, VT 05403 So. Burlington, VT 05403 Stuart & Helen Hall Harry & Patricia Davison Patricia Calkins 1815 Spear Street 1827 Spear Street 1835 Spear Street So. Burlington, VT 05403 So. Burlington, VT 05403 So. Burlington, VT 05403 George & Shelly Vinal Mark S. Westergard Barbara Lande 1845 Spear Street 1344 N. Windomere 1865 Spear Street So. Burlington, VT 05403 Dallas, TX 75208 So. Burlington, VT 05403 William Reed Harry Stone James McNamara 1967 Spear Street 29 Rangely Rd. 211 Killarney Dr. So. Burlington, VT 05403 Chestnut Falls, MA 02160 Burlington, VT 05401 Alan & Diane Sylvester Kenneth & Cheryl Goodwin Harlan & John Sylvester 1985 Spear Street 306 South Beach Road 51 South Street So. Burlington, VT 05403 So. Burlington, VT 05403 Burlington, VT 05401 Patrick & Juanita Clifford Rodolphe & Denise Vallee Littleton & Carolyn Long 4047 Spear Street 4043 Spear Street 1720 Spear Street Shelburne, VT 05482 Shelburne, VT 05482 So. Burlington, VT 05403 Littleton Long Lucien & Jane Demers Richard & Dawn Derridinger 1702 Spear Street P.O. Box 359 1575 Dorset Street So. Burlington, VT 05403 Essex Jct., VT 05452 So. Burlington, VT 05403 William & Gail Lang Shane & Holly Deridder Timothy & Jennifer Owens 1675 Dorset Street 192 Catkin Drive 197 Catkin Drive So. Burlington, VT 05403 So. Burlington, VT 05403 So. Burlington, VT 05403 Matthew & Beverly Broomhall Brian & Carolyn Terhune Stanley & Carolyn Pallutto 37 Floral Street 35 Floral Street 33 Floral Street So. Burlington, VT 05403 So. Burlington, VT 05403 So. Burlington, VT 05403 LISTor- /47r6vDE55 -Pt/Z 516V-11V 5Ht�7- 91710Y - a28 Bill Walford 53 Floral Street So.Burlington, VT 05403 Muriel More 9 Keari Lane So. Burlington, VT 05403 Sandra Lindberg 52 Pinnacle Drive So. Burlington, VT 05403 Jonathan Kleinman 39 Winding Brook So. Burlington, VT 05403 Ruth Trevithick 1751 Spear Street So. Burlington, VT 05403 Peter Smichenko 110 Holbrook Rd. So. Burlington, VT 05403 Eric Larson 29 Pinnacle Drive So. Burlington, VT 05403 Wendy Schroeder 257 Fairway Drive So. Burlington, VT 05403 Jared Larrow 77 Bower St. So. Burlington, VT 05403 Gail Schramm 1971 Spear Street So. Burlington, VT 05403 Mark Westergard 1344 N. Windamere Dallas, TX 75209 Martin Mara 1 ] 2 Catkin Drive So. Burlington, VT 05403 Mitchel Cypes 74 Bower Street So. Burlington, VT 05403 Eleanor B. Bensen 1803 Spear Street So. Burlington, VT 05403 Jeff Cunningham 83 Floral Street So. Burlington, VT 05403 Scot Rose 248 Quarry Hill Rd #71 So. Burlington, VT 05403 Lou Bresee 21 Cranwell Ave. So. Burlington, VT 05403 Nina & Devinder Sachdeva 181 Catkin Drive So. Burlington, VT 05403 Dan & Marquerite Wetzel 183 Catkin Drive So. Burlington, VT 05403 Robert Earlandson 26 Pinnacle Drive So. Burlington, VT 05403 Anthony Bianchi 29 Floral Street So. Burlington, VT 05403 Richard Spindler 12 Green Dolphin Drive So. Burlington, VT 05403 Susan Clark B-2 Stonehedge Drive So. Burlington, VT 05403 Doreen & Peter Allison 27 Floral Street So. Burlington, VT 05403 Patrick Clifford 4047 Spear Street Shelburne, VT 05482 Bill Cimonetti 1393 Spear Street So. Burlington, VT 05403 Ray Unsworth 1700 Spear Street So. Burlington, VT 05403 Nonna Aydinyan Clayton & Gayle Holmes Kerstin Lange 185 Catkin Drive 12 Ledoux Terrace 14 Birchwood Ct. So. Burlington, VT 05403 So. Burlington, VT 05401 So. Burlington, VT 05403 Bu ,ANDERSON T MELLONI PLC Counsellors at Law VIA HAND DELIVERY Mr. Ray Belair Zoning Administrator City of South Burlington 575 Dorset Street South Burlington, VT 05403 Michael L. Burak" Gateway Square • 30 Main street Jon Anderson Poet Office Box 787 Thomas R. Mellon" Burlington, Vermont 05402-0787 Michael B. Rosenberg' Phone: 802 862-0500 Shane W. McCormack -to Fax 802 862-8176 e-mail: attorney@vtlawl.eom www vtlawl.com "Also admitted in New York ❑Not yet admitted in Vermont •Also admitted in the District of Columbia #Also admitted in Massachusetts September 28, 2004 Re: Retrovest Master Plan Application #SD-04-01 Dear Ray: Enclosed for your files please find a copy of the letter I sent to the Development Review Board members on September 24, 2004. Ve truly yours, ! o Anderson 7 JTA\alb Enclosure S:AClient Matters\72835\Letters\jta belair4.doc BURAYvANDERSON MELLONI PLC Counsellors at Law Mr. John Dinklage, Chair City of South Burlington Development Review Board 16 Mayfair Street South Burlington, VT 05403 Mr. Mark L. Boucher City of South Burlington Development Review Board 20 Knoll Circle South Burlington, VT 05403 Mr. Larry Kupferman City of South Burlington Development Review Board 47 Central Avenue South Burlington, VT 05403 Ms. Michele F. Kupersmith City of South Burlington Development Review Board 23 Brewer Parkway South Burlington, VT 05403 Michael L. Burak` Gateway Square • 30 Main Street Jon Anderson Post Office Box 787 Thomas R. Melloni' Burlington, Vermont 05402-0787 Michael B. Rosenberg. Phone: 802 862-0500 Shane W. McCormaclOtEl Exx 802 862-8176 c-mail• attorney(u)%,tlawl.eonl *Also admitted in New Ibrk Iv%+'Ivxtlstwl. con] FiNot yet admitted in Vermont •Also admitted in the District of Columbia tAlso admitted in Massachusetts September 24, 2004 Mr. Chuck Bolton City of South Burlington Development Review Board 5 Prouty Parkway South Burlington, VT 05403 Mr. Roger Farley City of South Burlington Development Review Board 1416 Hinesburg Road South Burlington, VT 05403 Ms. Gayle Quimby City of South Burlington Development Review Board 64 Barrett Street South Burlington, VT 05403 Re: Retrovest Master Plan Application #SD-04-01 Ladies and Gentlemen: This letter outlines some major objections my clients Skip and Denise Vallee have to the draft findings of fact prepared by staff for this project as follows: On page 7, the draft findings of fact reason that neighborhood connectivity and housing may be balanced against the preservation of wildlife habitat and corridors'. We disagree. South I "The City has identified housing, the connection of neighborhoods, and wildlife protection as three (3) major priorities in the development of South Burlington. There is a challenge in balancing these priorities, as they are all in conflict with regard to Phase 3 of the proposed Master Plan." Mr. John Dinklage, Chair Mr. Chuck Bolton Mr. Mark L. Boucher Mr. Roger Farley Mr. Larry Kupferman Ms. Gayle Quimby Ms. Michele F. Kupersmith City of South Burlington Development Review Board September 24, 2004 Page 2 BURAK ANDERSON & MELLONIPLc Burlington could adopt an ordinance providing for such balance. Once any ordinance is adopted, however, it must be followed to the letter .2 The Development Review Board ("DRB") may not reinterpret your ordinance to weaken the absolute and nearly absolute protections for certain environmental amenities afforded by at least the following provisions: A. Absolute Protection for Wildlife Corridors and Habitat, Wetlands and Prominent Ridges The general standards applicable to all PUDS, subdivisions and Master Plans are: ... (4) The project's design respects and will provide suitable protection to wetlands, streams, wildlife habitat as identified in the Open Space Strategy ... South Burlington Zoning Regulations ("SBZR"), § 15.18 A (emphasis added) A Master Plan or PUD in the Southeast Quadrant District shall comply with the following standards:.. . (3) Existing natural resources on each site shall be protected through the development plan, including streams, wetlands, flood plains, wildlife habitat and corridors including those areas identified in the South Burlington Open Space Strategy and special natural and/or geologic features such as ... prominent ridges. SBZR, § 15.18B (emphasis added). 2 A force behind the recent permit reform bill, which I helped to develop and then authored the early drafts, was the Environmental Board's propensity to consider policy issues in permit review. The Legislature redirected all environmental appeals to a court, the best way to keep policymaking out of permitting. In policymaking, we write the rules. When permitting, we simply apply the rules as written. Kalakowski v. John A. Russell Corp., 137 Vt. 219, 224, 401 A.2d 906 (1979). SBZR, § 15.02 A(3) permits the modification of land development standards in conjunction with PUD review, but only to the extent such waivers comply with the standards in SBZR, Article 15 cited in this letter. Mr. John Dinklage, Chair Mr. Chuck Bolton Mr. Mark L. Boucher Mr. Roger Farley Mr. Larry Kupferman Ms. Gayle Quimby Ms. Michele F. Kupersmith City of South Burlington Development Review Board September 24, 2004 Page 3 BumK ANDERSON & MELLONIPLc The South Burlington Open Space Strategy, Map 9 (Attachment 1 hereto) identifies the Site as having one of the only two wildlife corridors wholly within South Burlington. Attachment 2 superimposes the wildlife corridor as located on Map 9 over the project as proposed. As may be seen, the applicant proposes not to protect such corridor as absolutely required by your zoning ordinance, but to block such corridor with the location of about 743 housing units. In addition, the site contains a great deal of wildlife habitat located mainly adjacent to the corridor identified in the South Burlington Open Space Strategy. This habitat is especially unique and important because of its quality and the relatively rare species found there including bobcats and the American Woodcock. (See Wildlife Report enclosed herewith.) SBZR, § 15.18 B(3) absolutely provides for the protection of such habitat. It does not allow reduction in such habitat as proposed by the Applicant. The same area contains a number of wetlands, which (after all these years) the Applicant is still identifying, and a ridge that is so prominent as to be identified as a restricted area. Indeed, the developer seeks to take advantage of the prominence of the ridge by marketing this phase of the proposed development as the "Ridge". Yet the Applicant proposes to locate about 74 housing units in this habitat3, on the prominent ridge, and, for whatever reason, after repeated tries without thoroughly identifying the wetlands. B. Maximization of Open Space Contiguity The general standards applicable to all PUDS, subdivisions and Master Plans are:.. . (6) Open space areas on the site have been located in such a way as to maximize opportunities for creating contiguous open spaces between adjoining parcels and/or stream buffer areas. 3 The draft findings describe the Applicant as proposing 111 units in this area. The August 25, 2004 plans, filed with South Burlington on August 31, 2004, however, show only 74 housing units in this area. Mr. John Dinklage, Chair BuRAK ANDERSON & MELLONIPLc Mr. Chuck Bolton Mr. Mark L. Boucher Mr. Roger Farley Mr. Larry Kupferman Ms. Gayle Quimby Ms. Michele F. Kupersmith City of South Burlington Development Review Board September 24, 2004 Page 4 SBZR, § 15.18 A (emphasis added). A Master Plan or PUD in the Southeast Quadrant District shall comply with the following standards: (1) Open space and development areas shall be located so as to maximize the aesthetic values of the property in keeping with the Comprehensive Plan goal of preserving and enhancing the open character, natural areas, and scenic views of the Quadrant, while allowing carefully planned development. (2) Building lots, streets and other structures shall be located in a manner that maximizes the protection of the open character, natural areas, and scenic views of the Quadrant identified in the Comprehensive Plan, while allowing carefully planned development at the overall base densities provided in these Regulations. (4) Consistent with (1) through (3) above, dedicated open spaces shall be designed and located to maximize the potential for combination with other open spaces on adjacent properties. SBZR, § 15.1813(1), (2) and (4) (emphasis added). The proposed development does not maximize opportunities for creating contiguous open spaces between adjacent parcels. It proposes, for example, to interrupt the connection of open spaces to be located on the north side of the property from open spaces on parcels to the south of the property by constructing a wall of as many as 74 housing units in between. Even if SBZR, § 15.18 B(1) and (2) are read to suggest a limited balancing -- the protection of some environmental amenities "while allowing Mr. John Dinklage, Chair Mr. Chuck Bolton Mr. Mark L. Boucher Mr. Roger Farley Mr. Larry Kupferman Ms. Gayle Quimby Ms. Michele F. Kupersmith City of South Burlington Development Review Board September 24, 2004 Page 5 BumK MDERSON & MELLONIPLC carefully planned development", § 15.18B(2) would permit balancing to occur only to the extent of development at the overall base densities provided in these regulations." Even the most favorable to applicant reading of SBZR, § 15.18B(1) and (2) would prohibit balancing to build more than about 266 housing units (1.2 x 222 acres) 4. C. Other Related Concerns 1. The Applicant proposes to locate 30% of his housing units in restricted areas. Although SBZR, § 9.08B. permits some development in restricted areas, such "development activities must be consistent with the intent and purposes of the Southeast Quadrant District. These include the encouragement (not discouragement) of green space preservation, scenic view and natural resource protection, wildlife habitat preservation and the location of lots and clustering of buildings to best preserve the open space character of this area. (emphasis added). 2. The Applicant proposes no permanent open space protection as, for example, through the granting of permanent easements to third parties. VW truly yours, 4A-� tolpi Anderson JTA\alb SAClient Matters\72835\Letters\jta dinklage4.doc 4 I used 222 acres as the approximate acreage of the site located in the Southeast Quadrant. The allowed base density of 1.2 units per acre in the Southeast Quadrant must be determined with reference to land located in the Southeast Quadrant without reference to the two or so acres of land located in Shelburne. ATTACHMENT 1 Legend 0 5 0 0.5 Miles Outstanding Resource Map South Burlington Open Space Strategy, Source City of South Burlington GIs Data dated October 2001 and VCGI Data (topography and adjacent municipaltes) Disclaimer Accuracy of these data is detennmeo ,by their so,irces Error and omissions may exist. goy;egA�e,ates s not responsitble for these 1 J. Boyle& Associates Landscape .Architects and Planning Con — 301 College Street Burin ton. Vermont C5401 g SOURCE: THE BASEMAP FOR THIS EXHIBIT IS A SCANNED IMAGE OF A PLAN ENTITLED "SOUTH VILLAGE, ILLUSTRATIVE PLAN" PREPARED BY LOONEY RICKS KISS ARCHITECTS, INC. FOR THE RETROVEST COMPANIES DATED MAY 10, 2004 (PROJECT #02.01047.04). THE WILDLIFE CORRIDOR ILLUSTRATED BY THE RED ARROW ON THIS MAP WAS OBTAINED FROM MAP #9 OF THE SOUTH BURLINGTON OPEN SPACE STRATEGY PREPARED BY T. J. BOYLE AND ASSOCIATES DATED APRIL, 2002. GRAPHIC SCALE aao m 4" sm (aae) l Irral a — R g W E a y a m z N RED ARROW INDICATES WILDLIFE CORRIDOR WILDLIFE CORRIDOR MAP The Verterre Group, Inc.' 414 Roosevelt Highway - Suate 200 CoWhester, Vermont 054M -1802) 654-M3 Wetlands and Wildlife Study Calkins Property South Burlington, Vermont September 23, 2004 �,.400 . a f ARRO WOOD ENVIRONMENTAL err 950 BERT WHITE ROAD HUNTINGTONXT 05462 (802) 434-7276 FAX: (802) 434-2102 Wetlands and Wildlife Study Calkins Property South Burlington, Vermont TABLE OF CONTENTS Page 1.0 OBJECTIVES........................................................................................................1 2.0 GENERAL APPROACH........................................................................................1 3.0 METHODS........................................................................................................ 1-3 3.1 Wetland Inventory Review......................................................................... 1-2 3.2 Wildlife Study.................................................................................2 3.2.1 Deer Wintering Yard Assessement...................................................2 3.2.2 Bobcat and Other Predators...................................................... 2-3 3.2.3 New England Cottontail..................................................................3 3.2.4 American Woodcock .....................................................................3 3.2.5 Wild Turkey .................................................................................4 3.2.6 Wetland Dependent Wildlife...........................................................4 4.0 RESULTS............................................................................................................. 4 4.1 Wetland Inventory Review.............................................................................4 4.2 Wildlife Study.................................................................................5 4.2.1 Deer Wintering Yard Assessment ................................................... 5 4.2.2 Bobcat and Other Predators....................................................... 5-6 4.2.3 New England Cottontail.................................................................. 7 4.2.4 American Woodcock.................................................................. 7-8 4.2.5 Wild Turkey................................................................................. 8 4.2.6 Wetland Dependent Wildlife......................................................... 8-9 5.0 Development Impacts..................................................................................... 9-10 6.0 Conclusions........................................................................................ ........ 10-11 Wetlands and Wildlife Study Calkins Property South Burlington, Vermont ATTACHMENTS Paqe SiteLocation Map.......................................................................................................1 WildlifeStudy Proposal........................................................................................... 2-3 Bobcat and Other Predators Study Map.....................................................................4 Vermont Fish and Wildlife Dept. Scientific Collection Permit......................................5 Cottontail Rabbit Study Map...................................................................... .......6 WoodcockStudy Map.................................................................................................7 WildTurkey Study Map..............................................................................................8 Wetland Dependent Wildlife Map....................................................................................9 Wetland Delineation Map..............................................................................................10 Wildlife Sightings Summary Table.................................................................................1 1 Bobcat and Other Predators Study Photos.............................................................. 12-13 New England Cottontail Data Summary Table..............................................................14 New England Cottontail Study Laboratory Data Sheets .......................................... 15-22 State of Vermont Correspondence, dated January 27, 2004........................................23 300' Wetland Buffer Map...............................................................................................24 Wetlands and Wildlife Study Calkins Property South Burlington, Vermont 1.0 OBJECTIVES Arrowwood Environmental, LLC (AE) was contracted to conduct a wetlands and wildlife evaluation of the Calkins property on Spear Street in South Burlington, Vermont. The Study was conducted in relation to the proposed South Village Communities, LLC development proposal. This report details the methods and conclusions of that study. 2.0 GENERAL APPROACH The purpose of this study is to evaluate wetland and wildlife resources on the Calkins property. The evaluation included a review of the wetland delineations on the subject property; an inventory and assessment of wildlife habitat on the property; and an evaluation of potential impacts of the proposed development proposal on wetland and wildlife resources on the property. A site location map is provided in the Attachment, page 1. The wetland delineation review involved site visits with the developer's wetland ecologist, Mr. Arthur Gilman, and the State Wetlands Office coordinator, Ms. April Moulaert. The intent of the review was to identify all of the wetland resources on the property and to determine the accuracy of the delineation of their boundaries. The wildlife evaluation focused on the identification of significant wildlife habitat on the subject property. Based on review of existing databases and familiarity with the property, the following significant wildlife and wildlife habitat were identified for evaluation in this study: • White Tailed Deer Wintering Habitat • Bobcat Hunting Grounds • New England Cottontail Breeding Grounds • Wild Turkey Breeding/Reproduction Grounds • American Woodcock: Breeding Grounds • Wetland Dependant Mammals and Birds Supporting Habitat In addition to the target species and habitats, AE also maintained a list of observations of other species of note seen or otherwise detected on the site. The methods utilized for the evaluation of wetlands and wildlife on the property are detailed below. 3.0 METHODS The study area identified in this evaluation is primarily defined as the Calkins property. As wetlands and wildlife habitat spill across property lines, the significance of these resources was evaluated in a local context as well. The following methods were used to conduct the wetlands and wildlife evaluation. 3.1 Wetlands Delineation Assessment Wetlands on the Calkins property were reviewed for the accuracy of their boundary delineation. The wetlands on the property were delineated by Mr. Arthur Gilman and Mr. Errol Briggs from the company William D. Countryman and Associates. The boundaries were determined in 2001 via the 1989 Federal Manual for Identifying and Delineating Jurisdictional Wetlands (8/8/01 Letter Report by Arthur Gilman). The process of evaluating the 2001 delineation involved remote and on site review. In order for an area to be considered a wetland, it must be characterized by hydrophytic (wetland) vegetation, hydric soils, and wetland hydrology. Prior to performing an onsite evaluation, SCS Soil Survey and National Wetland Inventory (NWI) maps were reviewed for the subject property. After compiling background information on soils and hydrology, a site investigation was conducted. The purpose of the site investigation was to review the flagged wetland areas and identify any additional wetland areas. 3.2 Wildlife Assessment The Calkins property was assessed for its value in providing the typical components of wildlife habitat including: food, water, and cover. Elements of more general wildlife habitat such as forested areas, as well as specific habitat elements that may play more critical roles for certain species, were also evaluated. Wildlife habitat elements were remotely investigated through the use of paper and digital maps, digital databases, and field investigation. A comprehensive review and interpretation of all available digital and paper databases was conducted to identify potentially significant wildlife resources on the property. GIS data layers utilized in the review include USGS topographic maps, 1990's orthophotography, SCS Chittenden County Soil Survey, Vermont Significant Wetland Inventory Maps, Natural Heritage Threatened and Endangered Species database, Department of Fish and Wildlife Dyer Wintering Habitat maps, Vermont Biodiversity Project Core Habitat database, and local parcel maps. Paper databases include the South Burlington Open Space Strategy and the Winooski Valley Park District's Where the Wild Things Are: Large Mammal Habitats and Corridors in South Burlington, Vermont. GIS coverage's were utilized to identify potentially significant habitat areas, and offer some insight into the quality of those habitats. While each layer by itself is limited in the information that it provides, review of multiple layers provides a much clearer view of the significance of an area relative to its immediate surroundings and its broader context in a community. The field investigation portion of the study was conducted over a 15 month period (March 2003 to June 2004). Within this timeframe the Wildlife Study Proposal (dated June 13, 2003) was implemented. The Proposal is provided in the Attachment, pages 2-3. The following methods were used for the on site evaluation of wildlife habitat on the Calkins property. 3.2.1 White Tailed Deer Site evaluation focused on identification of scat (number and frequency), evidence of winter browse and overhead cover and general habitat quality. The deer wintering habitat assessment was conducted on April 15, 2003. 3.2.2 Bobcat and Other Predators Site evaluation focused on the presence and degree of use of the property by predators. Monitoring was conducted with two remote IR triggered camera devices positioned onsite. Cameras were located in the central portion of the property. Station locations are shown on the Bobcat and Other Predators Study Map included in the Attachment, page 4. Monitor stations were baited with road killed deer provided by Vermont Department of Fish and Wildlife 2 Game Warden Mr. Chris Clark. Remote cameras were checked weekly over the period of December 12, 2003 to January 22, 2004. 3.2.3 New England Cottontail Rabbits were trapped for the purpose of species identification and potential documentation of presence of the New England Cottontail (Sylvilagus transitionalis). The New England Cottontail rabbit is listed by the State of Vermont Department of Fish and Wildlife as a species of special concern. The extent of current range for this species is unknown within the state of Vermont. A Vermont Fish and Wildlife Department Scientific Collection Permit was issued on 8/19/03 for the purposes of this study. The Permit is included in the Attachment, page 5. Much of the recent research on New England Cottontail identification has been conducted under the direction of John Latvaitis at the University of New Hampshire, Durham, NH. This study used techniques detailed in A Field Method to Differentiate New England and Eastern Cottontails, Litvaitis, J.A., D.L. Verbyla, and M.K.Litvaitis. 1991. Transactions of the Northeast Section of the Wildlife Society 48:11-14, with additional information from Sampling Protocol for New England Cottontail Inventory, Litvaitis J., obtained from the author. Trapping took place during winter months when pelage characteristics are most distinct. Six live Have -a -Heart type traps were set on the property and baited with apples and carrots. Station locations are shown on the Cottontail Rabbit Study Map included in the Attachment, page 6. Traps were checked daily. Trapped individual Lagomorphs were identified using techniques set out by Litvaitis including: • Pelage coloration- dark spot between ears for S. transitionalis, white spot between ears for S. floridanus. • Dark leading edge of ear for S. transitionalis. • Size of ear • Hair sample if S. transitionalis was suspected • DNA assessment conducted on select samples Additionally, photographs of each suspected S. transitionalis were taken as possible and field data sheets detailing each field visit and trapped individual were completed. All trapped rabbits were released at the trap site immediately upon completion of data collection. Any other incidentally trapped animals were noted and released immediately. 3.2.4 American Woodcock The evaluation focused on determining the significance of the Calkins property for breeding habitat for American Woodcock (Scolopax minor). Arrowwood ecologists/technician entered the property at or near dusk during suspected breeding times. Site visits for the purpose of locating American Woodcock breeding behavior took place periodically between late March and late May 2004. Attempts were made to visually and audibly identify displaying males. Field notes were maintained detailing numbers and approximate locations of all Woodcock identified. Survey locations are shown on the Woodcock Study Map included in the Attachment, page 7. 3.2.5 Wild Turkey On -site evaluation focused on the identification of roosting, feeding, and breeding behavior among Wild Turkey and determining the significance of habitat for Wild Turkey (Melaegris gallopavo) on the study property. Periodic field surveys were conducted during the breeding and nesting season on the property. Site visits for the purpose of locating Wild Turkey breeding and nesting behavior took place periodically between mid April and late May 2004. The field surveys focused on presence of Wild Turkey on site. In particular, breeding and nesting behavior was sought through calling (imitating the Turkey's vocalization) and observation of suspected nesting areas. Wild Turkey hens are susceptible to nest disturbance and have been shown to abandon nests at slight disturbance. All attempts were made not to disturb nesting birds, and priority was given to maintaining respectful distance over identification of nests. Birds and evidence of their presence were photographed when possible. 3.2.6 Wetland Dependent Mammals and Birds The field survey for wetland dependent mammals and birds consisted of monitoring for presence/absence of mink, or other wetland dependant mammals such as otter and muskrat with the use of baited track plates in protective boxes at the property edge, tracking on the subject property, and visual observation of wetland dependent birds on the subject property. Visual checks of the pond and wetland areas were performed during site visits for other monitoring components. 4.0 RESULTS The results of the wetlands and wildlife assessment on the Calkins property are presented below. 4.1 Wetland Delineation As a result of the remote and field assessment conducted by AE, inaccuracies in the 2001 wetland delineation and additional wetland areas were identified within the southern portion of the study property. See attached Wetland Delineation Study Map, page 10 of the Attachment. The wetlands on the property were reevaluated by Mr. Arthur Gilman and some boundaries revised along the southern portion of the parcel. Subsequent to this activity, a site visit was conducted with Ms. April Moulaert from the Vermont Wetlands Office. During this site visit Ms. Moulaert requested additional delineation work be conducted along the eastern drainage and that wetland areas identified as noncontiguous to the main Class II wetland be reevaluated. As of the writing of this report, i;-ie Wetlands Office has not reviewed or approved the requested changes. On August 23, 2004, an additional site visit was conducted with Dori Barton (Arrowwood Environmental wetland ecologist) and Mr. Gilman to review wetlands in the southern portion of the site. The result of this visit was the identification of eleven additional "problem areas" as identified on the attached map, page 10 of the Attachment. The problem areas are to be reevaluated as potential wetland areas by Mr. Gilman. As of the writing of this report, the wetland delineations on the subject property are not complete. 4.2 Wildlife Assessment The Calkins property is characterized by a variety of community types: meadow, old field, early successional scrubland, pine 4 forest, oak forest, wetland marsh and pond, and green ash swamp. These communities and their edges provide important habitat to a variety of wildlife. The Calkins property and surrounding area is one of the most valuable wildlife habitats in the South East Quadrant (SEQ) and South Burlington as a whole. This cluster of forested, wetland, scrubland, and open meadow vegetative cover types serves as habitat for a diverse group of species. With all of the habitat elements it has to offer: cover (including winter cover) for a wide variety of species; food resources for predators and browse for prey species; area for larger than normal South Burlington populations; nesting and breeding sites for waterfowl, grassland birds, upland birds and turkeys; water in the form of a pond, streams, and many wetlands; this is an extremely valuable parcel for resident and seasonal wildlife use. The wildlife observed or that have left sign of their presence through other means (tracks, scat, and other markings) associated with the brushy, open fields (including wetland marsh and pond areas) include: Wild Turkey, American Woodcock, Mink, Muskrat, White Tailed Deer, Cottontail Rabbit, Hawks (Rough Legged, American Kestrel, Red Tailed, Sharp Shinned and Northern Harrier), Canadian Geese, American Bittern, Mallard ducks, Song Sparrows, Yellow Warblers, Solitary Sandpiper, Chipping Sparrows, White Throated Sparrows, Yellow Throated Warblers, Veerys, Phoebes, Grey Tree Frogs, Spring Peepers, and other amphibians. In addition, many grassland birds have been identified on the property exhibiting nesting behavior including: Bobolinks, Eastern Kingbirds, and Savannah Sparrows. Of note, are the recorded observations of upland sandpiper nearby in Shelburne and Charlotte. The Calkins property may provide appropriate habitat for the nesting of this rare grassland bird as well. In addition, the wooded areas (including forested wetland areas) in the eastern portion of the property have revealed many additional species including: Bobcat, Deer, Moose, Ruffed Grouse, Coyote, Fisher, Grey and Red Fox, Long Tail Weasel, Raccoon, Skunk, Red Squirrel, several small rodents, and many other species of birds. While a variety of mammals and birds have been identified on the property, this wildlife assessment focused on target species and habitat for review. The results of the target species and habitat assessments are detailed below. A wildlife sightings summary data table is included in the Attachment, page 11. 4.2.1 Deer Wintering Yard Assessment The conifer forests that are located in the center and eastern portions of the Calkins property were evaluated for deer winter habitat. Field investigation revealed that the forest areas were not utilized by over -wintering deer during the winter of 2002-2003. The winter of 2002-2003 was particularly harsh and most deer wintering areas in the State were used by deer. The forests on the Calkins property exhibited little to no sign of use during the winter of 2002-2003, as evidenced by a lack of scat and/or browse. 4.2.2 Bobcat and Other Predators Bobcat and other predators were targeted for evaluation of presence and use on the Calkins property. Bobcat in particular was identified due to proximity to recorded sightings in the surrounding area (Shelburne Pond) and because of the significant prey base on the property. Bobcat presence was evaluated by installing bait stations and tracking in the 5 winter. The bait stations were deployed in the eastern portion of the property, one at the north end of the central pines near the pond (CS#1), one to the west of the central pines at the edge of the Green Ash Swamp (CS#1 A) and the other at the north end of the eastern pines (CS#2). See Bobcat and Other Predators Study Map for station locations, page 4 of the Attachment. Bobcat feeding activity was observed at CS#2. While bobcat did not feed at CS #1 and CS#1 A , bobcat tracks were observed in the area of these stations. Given the abundance of cottontail rabbits, prey base for many predators; it is not surprising to find evidence of bobcat feeding at deployed bait stations on the property. Significant use of the area was documented through track, scat, scent marking, and bait disturbance. Although the bait was positioned near remote cameras with the intention of procuring photographs of the visiting animal, the severe cold weather of the 2003-04 winter caused camera malfunction. Presence of bobcat was none -the -less easily determined during routine camera maintenance visits. The signs of presence were documented with photographs, see pages 12-13 of the Attachment. Of added significance is the role that the Calkins property plays in the local ecology of the area. The Calkins property not only provides food for predators but also serves as a linear connection, or corridor, between the large wetland/upland forest to the north and west (the Great Swamp) and large forested areas to the south, including Shelburne Pond. The presence of this wildlife corridor was confirmed by tracking in the winter of 2003/2004. In January 2004, a bobcat was tracked from the northern end of the eastern pines across the eastern wetland drainage, through the central pines, off the property to the next forest patch to the south. See Bobcat and Other Predators Study Map for track location on page 4 of the Attachment. The South Burlington Open Space Strategy identifies the area where the bobcat track was followed as a wildlife corridor on the subject property. It is clear that the large forested area to the north and west of the property is connected to other large forested areas in the Shelburne Pond area through the Calkins property. See Bobcat and Other Predators Study Map on page 4 of the Attachment for corridor location identified in the South Burlington Open Space Strategy. Wildlife, in particular bobcat which has been recently recorded denning in cliffy areas near Shelburne Pond and quite possibly in the larger core habitat area adjoining the property, are utilizing the subject property not only for food and water but for travel between source habitat areas. Other predators identified on the property over the course of this study include coyote, fisher, red and grey fox, long tail weasel, mink, and various hawks (red tailed, rough legged, sharp shinned and northern harrier). Coyote and Red Fox tracks were identified throughout the property. Grey Fox tracks were identified in the eastern portion of the property. Mink tracks were identified within the western wetland drainage and along the stream (Munroe Brook). Northern Harriers were observed in the wetland marsh area to the north of the central pines on numerous occasions. On two occasions in May 2004 two Northern Harriers (male&female) were observed demonstrating likely nesting behavior. Locations of Bobcat and other predator sightings on the subject property are shown on the Bobcat and Other Predators Study map on page 4 of the Attachment. 4.2.3 New England Cottontail Study Field visits to the Calkins property and adjoining parcels by AE ecologists and field technician have identified the presence of an abundance of rabbits on the property. Additionally, the land cover is appropriate habitat for both S. transitionalis and S. floridanus. The purpose of this study was to determine whether the rabbits on the property are S. transitionalis, S. floridanus, or both. The Calkins property was assessed from November 22, 2003 to November 27, 2003 for the presence of New England Cottontail rabbits. Six trapping stations were deployed on November 21, 2003 on the subject property. Station locations are shown on the Cottontail Rabbit Study Map included in the Attachment, page 6. Each of the six stations was visited on a daily basis. Field data sheets were completed for all trapped rabbits. Information collected for each rabbit included weight, ear length, field observations, photographs, and hair samples. Data from the field sheets is provided in summary form in the Attachment, page 14. Over the course of the study fifteen rabbits were caught and assessed. Of the fifteen specimens, four were submitted to the Northeastern Wildlife Genetics laboratory for genetic analysis of hair samples for species identification. 112203/3/DB 112203/6/DB 112303/3/DB 112603/6/DB Of the submitted samples, 112203/3/DB, 112203/3/DB and 112603/6/DB were found to have the genetic markers of the eastern cottontail. The laboratory is in the process of rerunning sample 112203/6/DB. Laboratory results are included in the Attachment, pages 15-22. The rabbits caught and assessed during this study were determined to be Eastern Cottontail rabbits. 4.2.4 American Woodcock Woodcock males perform an elaborate courtship flight display during the breeding season in early spring often between mid March and Mid June. Breeding habitat is most often old fields that have begun to grow up to brush and trees. Woodcock breeding territory has been estimated to be about 1 pair per 6 acres. Three woodcock study areas were defined on the southern portion the subject property. Each of the study areas is characterized by early successional scrubland, primarily dogwood. Study Area #1, located to the west of Munroe Brook is approximately 13 acres in size. Study area #2 is located to the east of Munroe Brook and to the west of the central pines area. Study Area #2 is 16 acres in size. Study area #3 is located to the east of the central pines area and is approximately 7 acres in size. Survey locations are shown on the Woodcock Study Map included in the Attachment, page 7. The property was visited on 5 evenings from March 27, 2004 through May 14, 2004. Woodcock breeding behavior was observed either in the form of visual observation of courtship flight display and/or auditory observation of male singing on the ground on each of the visits. Table #2: Number of Woodcock Exhibiting Breeding Behavior Date Study Area #1 Study Area #2 Study Area #3 3/27 4-5 NV NV 7 4/6 4-5 NV NV 4/20 2 1 NV 4/30 2 2 NV 5/14 NV 2 0 Note: NV=Not visited As the data show, Study Area's 1 and 2 exhibit the highest degree of use by breeding woodcock. The average number of breeding males observed in the approximately 28 acre area was 4 on a given evening. This represents an estimated 7 woodcock per acre, higher than the expected 6 per acre. Such a high number of woodcock is an indication of the quality of habitat on the subject property. The early successional brushland, predominated by dogwood shrubs and noticeably absent of tree saplings, is providing significant habitat for the breeding of this species. 4.2.5 Wild Turkey Breeding behavior among Wild Turkeys in Vermont occurs from mid -April through the month of May. The male Turkeys (toms) seek out females (hens) who vocalize their availability. Toms begin their call when coming off the roost at dawn. The tom will vocalize their characteristic gobble call and listen for the clucking response of a hen. Monitoring for wild turkey on the subject property occurred in the winter and spring of 2004. Turkey tracks and scat were observed throughout the property. Roosting was observed in the central and eastern pines throughout the winter. Roosting was observed in the central pines in the spring as well. Monitoring for breeding was conducted in the spring of 2004. Calling toms were heard on one occasion and a displaying tom was observed offsite in the spring of 2003. Wild turkey hens were observed on several occasions in the area to the west of the central pines and south of the green ash swamp, both on the east and west sides of Munroe Brook. On July 22, 2004, a hen with ten young was observed in the open meadow to the north of woodcock Study Area 1. Survey locations are shown on the Wild Turkey Study Map included in the Attachment, page 8. The results of the wild turkey monitoring are confirmation that wild turkey is not only present on the subject property, but are also breeding and reproducing. 4.2.6 Wetland Dependent Mammals and Birds The wetlands on the subject property are rich with wildlife. The wetlands are a complex ecological system with wet meadow, open water, marsh, scrub shrub and forest community types. Munroe Brook flows through the wetland contributing to the variety of wildlife habitats present. The Class II wetland complex on the study property is significant for providing protected travel routes and feeding and breeding habitat for a variety of wetland dependent wildlife species, including a number of small and medium size mammals and birds. Over the course of this study, sign of mink and muskrat was identified in the wetland complex and/or along the Munroe Brook drainage. Mink tracks were observed on several occasions from March 2003 to June 2003 at the southern property boundary along Munroe Brook prior to the commencement of onsite study evaluation. Mink tracks were also observed in wetland areas and along the entire stream corridor on the subject property subsequent to the start of on site investigation in June 2004. Sign of muskrat was also observed on the property. A muskrat lodge was identified in the marsh wetland to the west of the open water pond in January 2004. Evidence of recent activity was also observed at this time in the form of tracks and runs in the snow. 8 The study results show that the property is significant for wetland dependent wildlife. In particular the extensive Class II wetland complex, including the stream corridor, contains evidence of active use by muskrats and mink. In addition to small and medium size mammals, the wetland has habitat to support breeding waterfowl and migratory birds. In the spring of 2003, an American Bittern was identified in the vicinity of the open water pond. Mallard ducks were identified during the spring of 2003 from an adjoining property flying over the subject property. In the spring of 2004, mated mallard ducks were observed in the open water pond and along the water course of Munroe Brook. On May 11, 2004, a hen with ten ducklings was observed in the green ash swamp. Male and female northern harriers exhibiting nesting behavior were identified to the north of the pond in the marsh wetland. Canada geese were observed flying over the property and resting in the marsh area to the west of the pond, and in the pond itself. Locations of wetland dependent mammal and bird sightings on the subject property are shown on the Wetland Dependent Wildlife Study map on page 9 of the Attachment. The results of the study of the property for significant migratory bird habitat is that the property has extensive habitat diversity actively supporting one or more breeding pairs or broods of waterfowl, providing resting, staging and roosting habitat to support waterfowl migration, and likely supports a nest site and/or feeding habitat for American bittern and northern harrier. The data collected in this study verifies that the wetland complex on the subject property is significant for wildlife and migratory bird habitat. Wetlands and flooded areas on the property are used by migrating shorebirds as stopover points as evidenced by the presence of sandpipers. 5.0 Development Impacts The South Village Communities, Inc project involves the development of 300+ residential units in three phases on the Calkins property. The proposed development, in particular Phase 2 The Ridge, involves the placement of residential units and the development of roads and walking paths directly adjacent and within the main Class II wetland complex. As a result of the proposed development, valuable wildlife habitat will be lost and species diversity diminished on the subject property and in the local area. The forest and wetland areas on the subject property are part of a 175 acre wetland/forest complex (Great Swamp) extending to the north and east of the property. Expanding from that is an additional area comprising 400-500 acres of varied landscapes including upland forest, early successional scrublands, old fields, and open space. This large area is an anchor/ source area for wildlife in the western SEQ and a vital connection to Shelburne Pond to the southeast. This wetland/forest complex is one of the largest undeveloped areas in forest cover remaining in South Burlington. This forest and wetland have been undeveloped since at least the 1940's and has provided habitat for wildlife for a long time. Development to the south and east has already fragmented this 150-200 acre wetland and forested area. The proposed development will cause further fragmentation and possible loss of habitat for medium-sized wildlife (such as bobcat, fox, forest hawks, and deer) and 9 water/wetland related species (such as mink, waterfowl, and Northern Harrier). The proposed development will place large numbers of roads, houses, lights, people and pets directly adjacent to and within the western boundary of a major wetland and large forest area. This development will result in the introduction of physical, visual and auditory intrusions into the wetland, stream and forest habitat, compounding existing intrusions from development to the east. The development as proposed generally provides for 50' buffers to Class II wetland resources on the property, except for three proposed wetland crossings to access Phase 2 The Ridge. The 50' buffer distance is a requirement on Class II wetlands per the Vermont Wetland Rules and often a minimum recommendation through Act 250. In cases such as this where wildlife resources are significant, greater buffer distances are often necessary for adequate protection of the resource. The State Wetlands Office and Department of Fish and Wildlife has recommended (See letter included in Attachment, page 23), and we agree, that the protection and preservation of the wetland and wildlife resources on the property requires the elimination of all wetland crossings and the maintenance of an undisturbed 300' buffer on the main Class II wetland complex. See 300' Wetland Buffer Map in Attachment, page 24. The proposed development will not only fragment the wetland and forest area, but will also destroy large areas of early successional shrubby habitat, shown as Study Areas #1 and #2 on the Woodcock Study Map, page 7 of the Attachment. The loss of this habitat will result in a major decrease in prey habitat for bobcat, hawks, coyotes, and the like. This loss of prey, 10 including cottontail rabbits, combined wi:h an increase in fragmentation of this now largely contiguous habitat (semi -wild [old field] and wild) will result in species such as bobcat not continuing to visit the area. The development will result in the reduction in wildlife populations by reducing access to specific habitat elements (i.e. prey habitat). The proposed project will result in the dissection of the upland forest habitat, further isolating this large wildlife area from others, particularly to the south. The South Burlington Open Space Strategy has identified the forest areas on the property as corridor connections to the large forest areas to the north and west, and to the wild areas to the south. The results of this study show the migration of wildlife (bobcat in particular) from the subject property to the south towards Shelburne Pond. Fragmentation and disturbance of habitat (including streams, wetlands, and forests) by houses, people, pets, culverts and roads will result in the overall loss of habitat and species diversity on the property and the surrounding area. 6.0 Conclusions Due to the presence of a variety of habitat conditions, the Calkins property has a wealth of habitat suitable to wildlife species such as deer, moose, bobcat, fisher, coyote, porcupine, rabbits, muskrat, mink, otter, hawks, ducks, geese, turkeys, woodcock and numerous songbirds. The white pines on the property provide for turkey roosting; the early successional scrublands provide ideal circumstances for a solid prey base for predators such as bobcat, coyote and fox and breeding grounds for woodcock; the wetlands provide supporting habitat for mink and muskrat; and the combination of open fields and wetlands provide habitat for northern harriers which are likely nesting on the site. The long-term viability of area -sensitive wildlife (black bear, moose, and bobcat) depends on the preservation of not only large habitat areas but also connections between those areas. Fragmentation of core habitat areas from land use activities such as residential housing and roads, generally results in a decline in wildlife populations and diversity. Smaller tracts of forest serve as corridor connections with and between the larger and more highly significant habitat areas. Wildlife are dependent upon these travel routes to meet their seasonal requisites, such as food, water, and cover. These areas are large enough to find bobcat, white-tailed deer, moose, fox, coyotes, the occasional black bear, and many songbirds. These areas also provide for fish and aquatic wildlife habitats. The South Burlington Open Space Strategy identifies the Calkins property as such an important wildlife corridor. Failure to avoid wetland impacts and to provide adequate buffers to significant wetland and upland resources will result in the loss of diversity in wildlife habitat and wildlife utilizing the area (particularly loss of bobcat, wild turkey, woodcock, wetland dependent wildlife, and raptors). The combination of habitat types on the Calkins property is unusual and unique in South Burlington. Preservation of the wildlife habitat and wildlife diversity on the property requires careful consideration of the property as a whole. Failure to review the impacts of the proposed development on those resources as a whole is likely to result in the loss of numbers and diversity of wildlife on the property and the broader SEQ. Wetlands and Wildlife Stud Calkins Property, South Burlington Vermont Attachment, Site Location Map page 1 9/21104 Miles 0 0.25 0.5 1 1 inch equals 1 miles ` WOOD ENVIRONMENTAL 750 BERTVVHTFE ROAD FARMYGTON.VT OS462 (BD2) 434.7276 FAX: MU) 4342102 ARRO,• WOOD ENVIRONMENTAL 950 BERT WHITE ROAD HUNTINGTONYT 05462 (802) 434-7276 FAX: (802) 434-2102 Wildlife Study Proposal South Village/Retrovest Development on Caulkins Property, South Burlington, Vermont June 13, 2003 The following significant wildlife has either been observed or is suspected to occur on or near the South Village site in South Burlington, Vermont: 1. White Tailed Deer- potential important wintering habitat 2. Wild Turkey- potential breeding/reproduction grounds (Spring Monitoring) 3. Bobcat- potentially significant hunting grounds 4. New England Cottontail- potential breeding area for this rare species 5. American Woodcock- potential breeding grounds (Spring Monitoring) 5. Wetland Dependant Mammals (mink)- potential supporting habitat 7. Wetland Dependant Birds- potential supporting habitat for Ducks, Geese, American Bittern The following methods are proposed for the evaluation of use and/or presence or absence of the above species. Each species is noted with proposed monitoring techniques and frequency of monitoring visits to site. 1. White Tailed Deer • Evaluate site for number and frequency of scat, evidence of winter browse and overhead cover and general habitat quality. • One site visit lasting a couple of hours will be sufficient for evaluation. 2. Wild Turkey (This work is not possible during this field season) 3. Bobcat and Other Predators (Two months necessary for adequate data collection) • Monitor for presence with two remote IR triggered camera devices positioned onsite. < • One camera location each at North and South ends of property, exact locations to be determined by field evaluation. • Suggested baiting: road killed deer (will require cooperation with Vt. Dept. of Fish and Wildlife), or other large source. • Cameras will be checked weekly, left installed for at least two months. • Set up site visits: Approx. four hours. • Camera maintenance site visits: Approx. one hour 4. New England Cottontail • Evaluate for presence through the use of live trapping at locations to be determined by field visit. • Live traps would require frequent (daily) monitoring for the extent of the study period. • Suggested initial study window of one week. 5. American Woodcock (This work is not possible during this field season 6. Mink • Monitor for presence/absence of mink or other wetland dependant mammals such as otter and muskrat with the use of baited track plates in protective boxes. • Set up visit: 1 hour • Weekly maintenance visit: lhour (Combine with camera check) for 2 months. 7. Wetland/Pond Dependant Birds (Results inconclusive due to late season start) • Visual checks of pond and wetland area to be performed during site visits for other monitoring components. • Additional time negligible. Wildlife Study: Proposed Monitoring Schedule for Summer 2003 Site visit for initial evaluation/set up Personnel: Project Biologist, Field Technician Time: Late -dune Evaluate Deer Wintering Habitat Set up remote camera stations/bait pile Set up/bait for NE cottontail rabbit live traps Set up track plate/bait box stations Observe for water owl & other wecies sign Visit duration- one day (8 hours+/- onsite) Maintenance Visits for NE Cottontail Rabbit monitoring, sight checks for water owt Personnel: Field Technician Time: One hour onsite daily for one week following set-up Maintenance Visits for camera/track plate stations, sight checks for water owl Personnel: Field Technician Time: Two hours onsite weekly for 2 months following set up 2 S.Burlington L TAW Wildlife Corridor 1 s s Camera Station Y, CS#2 Camera Station - = CS#1 r., - x,# - `- ■ f `F" r,ti.- Camera Station "' ? Yx. , ' �.- r 4Ci a y. 2 Z7 & 3 u - ic) t1j -- -._ - •- LEGEND ► �t \ _N � • — t Bobcat Streams Grey Fox Pond :^a L. Tailed Weasel — So.Burl. Open Space I " - Strategy, Wildlife Corridor Mink Class II Wetlands (J Raptors notes: Predator sightings are approximate. Remote camera sites from Class III Wetlands consumer grade GPS data collected by Arrowwood Environmental. Red Fox Wetlands and Property Imes from Retrovest South Village Ian dated —• Property Lines P rtY 9 P ❑ccc1 Bobcat Track 6/28/04. Surface water from VCGL Orthophotography from Vt. Mapping Calkins Property program. Wildlife corridor arrow from City of South Burlington Open Q Remote Camera Space Strategy. This map is intended to depict approximate locations note: coyote sign was observed throughout the property, of certain wildlife sightings by Arrowwood Environmental ecologists, 74M_ _ r errors may exist. Feet Wetlands and Wildlife Study 0 100200 400 60o so0 Calkins Property, South Burlington Vermont 1 inch equals 600 feet Attachment, Bobcat and other Predators Map /_� fir' ARRO WOOD ENVIRONMENTAL {SV' +. r 950BMTWHITE ROAD HUNFrWGTON.VT 05462 (e02)+3+-7276 rax MM) 434-2102 Page 4 9/21 /04 HL'G-Sb-'L�16�3 �� LfS Hf`7 J t l- r- r' H K r: U rim i 44:dU46046 1. PERMITTEE: VEII.riI ONT FISH AND WILDLIFE DEPARTMENT 103 South Main Street, 10 South Waterbury, VT 05671-0501 802-241-3 700 2, PRINCIPAL OFFICER: - SCILNTIFIC COLLECTION PERMIT STATUTORY AU'rHORITY: 10 VSA SECTION 4152 Jeffrey Parsons P,O. Box 34 Lowell, VT 05847 802-744-2043 3. EFFECTIVE DATE: 8/25/03 EXPIRES: IOi31/03 4. -AUTHORIZED SPbQES-:•N4-w-Vng1and cottontall tSylvilaWu !ran giogalis}�,d ec�tern-o( iontail {S- flaridaim 5. LOCATION WHERE AUTHORIZ D AC'TIVI.TY MAY BE CONDUCTED: South Burlington, 6. C:'ONDTTIONS AND AUTHORIZATIONS: A. General conditions stet out in 10 VSA are hereby made a part of this pernut. All activities authoti.zed herein trust be carried out in tacuird with and for the purposes described in the application Submitted. Continued validity or renewal of this permit is subject to complete and timr_ly compliancy with all applicable conditions, including the tiling, of tall required infor:'tlat.ion and reports. B. The validity of this permit is also conditioned upon strict observance of all applicable foreign, fcdertal, focal ur Other state laws. C. This permit is not valid for t:ig game or Federal and State endangered and threatened species unless indicated, D. Valid for use by perntittee named ahovc. Authorized subpertnit(ees: Aaron Worthley, Dnrl Barton. E. Authorized to capture rabbits using Havahart live traps and examine spLoitttctis for identification purposes before releasing uttl)a.nned on site. This is for a study to determine. whether New Enghuid cotiontail is present in the area. Rabbits shall be handled in it humane, m,mner and effort ;.hall ba made tit ininimize injury. F. ' Landowner permission is required. 7. RRPOR`!'ING ILEQ(JIREP✓I.L1' TS: Ana,ual report due within 30 days following permit expiration. 4yne A. Laroche, Commissioner Station #52 - # �► Trap Station #6 y _ $7 1- ,+ion #3 � n sr A'.R a '�° Trap Station Trap Station £ •4} 1 I '. R — .— — - u LEGEND =.z Cottontail Trap Site Class III Wetlands notes: Trap sites from consumer grade GPS data collected by Pond Arrowwood Environmental. Wetlands and Property lines from —� Streams Retrovest South Village plan dated 6128/04. Surface water from Class II Wetlands Calkins Property VCGI. Orthophotography from Vt. Mapping program. This map is — — Property Lines intended to depict locations of New England Cottontail study sites b Arrowwood Environmental ecolo fists, errors may exist. Wetlands and Wildlife Study 0 100200 400 600 $OOFeet Calkins Property, South Burlington Vermont 1 inch equals 600 feet 9 Attachment, Cottontail Rabbit Study Map ARRO"'HVOOD ENVIRONMENTAL T sso eocrWHITE aono HUNTINGTON.VT U_,462 page 6 9/21 /04 (902) 434-7276 FAX (802) 434-2102 A, / z 4 4 ff , : • k ' 1 ram• . �` t:�.../--• ,�?. � � ram: --r r- t 1 Study Area #1 Study Area #2"� ^&fatly Area #3', 16 acres 6.8 acres �t LEGEND '■ Woodcock Study Areas Class III Wetlands' notes: Study Areas determined by Arrowwood Environmental. Streams - Pond Wetlands and Property lines from Retrovest South Village plan dated 6/28/04. Surface water from VCGI. Class II Wetlands Calkins Property Orthophotography from Vt. Mapping program. This map is * intended to depict locations of American Woodcock study sites — — Property Lines b Arrowwood Environmental ecologists, errors may exist. Wetlands and Wildlife Study Feet _ o 100200 4W 600 >ioo v Calkins Property,South Burlington Vermont 1 inch equals 600 feet '- � • n-b Attachment, Woodcock Study Map eeeyyyt''' ARRO:'VVOOD ENVIRONMENTAL 950 N AD HUNTI GTONYTWHITE OS4 HUNTINGTON.VT 05162 page 7 9/21 /04 (B@) 434-7276 FAX (902) 434-2102 - i, s t I 1 Hen w/ _, Roost Site .. 10 chicks _ T -v r Displaying r= 4 I.Om L• Y'•�� T -r — r - c LEGEND 4T Wild Turkey Pond notes: Turkey sighting areas are approximate. Wetlands and Property lines from Retrovest South Village -�- Streams Calkins Property plan dated 6/28/04. Surface water from VCGI. Class II Wetlands — — Property Lines Orthophotography from Vt. Mapping program. This map is Class III Wetlands intended to depict locations of Wild Turkey sightings by Arrowwood Envirionmental ecologists, errors may exist. Wetlands and Wildlife Study Feet o ,00zoo .tom � �o Calkins Property, South Burlington Vermont 1 inch equals 600 feet Attachment, Wild Turkey Study Map � ROBERT� OOD ENVIRONMENTAL T ROAD HUNTINGTONYT05462 page8 9/21 /04 (802) 434.72]6 FAX: (802) 434-2IO2 itr o. ij �+ " Jf IJ � � ��,,;"�_ ��. .. a .• .... a-. �� --r, LEGEND ® American Bittern Streams <+> ® Canada Goose Class II Wetlands Y ;y e Class III Wetlands Mallard tT - - Pond. •i Mink Calkins Property ` UMoose —•••—• property Lines notes: Wildlife sighting areas are approximate. Wetlands and Property lines from Retrovest South Village ® Muskrat " plan dated 6/28/04. Surface water from VCGI. ® No. Hamer Orthophotography from Vt. Mapping program. This map is intended to depict locations of wetland dependant wildlife © Solitary Sandpiper sightingsby Arrowwood Environmental ecologists, errors may exist. Wetlands and Wildlife Study 0 100200 400 600 80Fee` _- 0 0 Calkins Property, South Burlington Vermont 1 inch equals 600 feet J-` 9 ��'; . e ARRO: WOOD ENVIRONMENTAL Attachment, Wetland Dependant Wildlife Map (� 950 BERTWHITE ROAD Y HUHTMGTON.VT 05462 page 9 9/21 /04 (902) 434-7276 FAX (802) 434-2102 ' JL �•1R sue'• �/, - _ rT ��, •; _� 3a. ' r: t •. �ya� x r _ i A. IL 41, Fr �,�,�� _ , .. -� � •R� J yy may�y. yy: J. i � �7'}�N' {I _ �, Vic- .r �, ♦�' }� �7. 'i ,� �St^. ?'1.. i�*. �� `I � I - - LEGEND problem areas Streams notes: Wetland Problem areas are approximate. Wetlands and Property lines from Retrovest South Village I Class 11 Wetlands ® Pond plan dated 6128/04. Surface water from VCGI. Orthophotography from Vt. Mapping program. This map is Class III Wetlands Calkins Property intended to depict locations of wetland delineation problem — — Property Lines areas identified byArrowwood Environmental ecologists, max, -• �:... errors may exist. �..44r z . Wetlands and Wildlife Study Feet 0 100 200 400 600 800 a Calkins Property, South Burlington Vermont 1 inch equals 600 feet .� 9 Attachment, Wetland Delineation Map ; ARRO✓.WOOD ENVIRONMENTAL N H-UrvNG—TOreoros4sz page 10 9/21/04 ceop 434.rzms FAX (M) 4i4-:102 I 1 63 �G�u_Omum f LL VJ f-FFNI- > F> H F-»?> »Q>Q j»» 7»»»» 4> Q»> 9>> S» 7»»»»»> S» »»»»»»» > Q> FF H f H g� fill $nSm €�90 oo Mold C REM3 Aa U Og. Hill" ills 3vfa>ia �S g�q�i �3 tits, ;a , : (s@m dtqu dpq dgpq dp �q adWq ��yCN : . �zN ym 2$g y 2 aaa'DSS in bi LS �iDi$fi Wc��i$�yr�� a S' U u�" •M g' � i o 0 g x x gg� c 3.tQ �KoiLLpLL o��x �p��° jQ�(W � j{xy}K$gpypy �q Je ��'� >. m$p m� q-y3py(.$a� 'pp p �� (�0a �E_] g tp� epgml� °� JC � p3E a •$_ m e�� T E�yE{ � � `o _E 2/� wilt Sz�Li'�� sUo U t EEE E �3 p� � Clt g $'� ail �C�i 3 �� "• R9 a7 y3 3 8 its g $�33 m g33 33� jig P m ys e 88. iv iov g s' n 1. Wild Turkey jpg 200310311714:34:41 3. Coyote Track.JPG 2003106106 11:03:00 y 5. Mink.JPG 2004101106 09:06:29 2. W.T. Deer rub.JPG 200310510710:16:26 4. Turkey Scat below Roost.JPG 2003112123 6. Grey Fox.JPG 2004101106 09:11: 55 d a 7. Bobcat jpg 2004101106 10:42:46 8. Bobcat Scat.JPG 2004101106 10:31:18 9. Bobcat track.JPG 2004101108 15:57:38 r? 706 t 11. Muskrat Track.JPG 2004101121 11:09:05 13. Solitary Sandpiper jpg 2004105112 06:37. 10. Bobcat Scent Mark jpg 2004101108 16: 09 12. Turkey.JPG 2004104130 19:22:23 Calkin's Property: New England Cottontail Rabbit Study South Burlington, Vermont Table 1: Data Summary Field Measurements Field Observations Station # Date Capture Model Hair Sample Sample DNA Analysis Photo Body Weight Ear Len th inches Black Spot White Blaze Dark Leading # (grams) Between Ears on Forehead Edge of Ear Results Taken # Results # Lett Right Station 1 11/22/03 0 11/23/03 0 11/24/03 0 11/25/03 0 11/26/03 0 11/27/03 0 Station 2 11/22/03 0 11/23/03 1 1243 2.5 2.5 N Y Y EC Y 1123032DB 8,9,10 11/24/03 1 1015 2.4 2.4 N N Slight EC Y 1124032DB 5,6,7 11/25/03 0 11/26/03 1 1530 2.5 2.5 N Y N EC Y 1126032 7,8,9 11/27/03 0 Station 3 11/22/03 1 1348 2.4 2.3 Y N Slight EC Y 1122033DB EC 4,5,6 11/23/03 1 1086 2.5 2.45 N N Y EC Y 1123033DB EC 4,5,6,7 11/24/03 0 11/25/03 0 11/26/03 0 11/27/03 1 1315 2.55 2.55 N Y Y EC Y 1127033DB 4,5,6,7 Station 4 11/22/03 0 11/23/03 0 11/24/03 0 11/25/03 1 1061 2.4 2.4 N Y Y EC Y 1125034DB 3,4,5 11/26/03 0 11/27/03 1 1108 2.4 2.45 N N N EC Y 1127034DB 8,9,10,11,12,13 Station 5 11/22/03 0 11/23/03 0 11/24/03 0 11/25/03 0 11/26/03 1 1600 2.45 2.45 N Y N EC Y 1126035DB 1,2,3 11/27/03 0 Station 6 11/22/03 1 1088 2.4 2.4 Y Slight Y EC Y 1122036DB NA 1,2,3 11/23/03 1 915 2.4 2.5 N Slight Slight EC Y 1123036DB 1,2,3 11/24/03 1 1357 2.5 2.5 N N Slight EC Y 1124036DB 1,2,3 11/25/03 1 936 2.45 2.45 N N N EC Y 1125036DB 1,2 11/26/03 1 1201 2.45 2.45 N Y Y EC Y 1126036DB EC 4,5,6 11/27/03 1 1291 2.52 2.5 Y N Y EC Y 1127036DB 1,2,3 1S Northeastern Wildlife Genetics May 26, 2004 Arrowwood Environmental Attn: Dori Barton 950 Bert White Rd. Huntington, VT 05462 Three samples (# 112203/6/DB, # 112303/3/DB, and # 112603/6/DB) of rabbit hair were received on February 24, 2004. Hairs were examined microscopically for the presence of hair bulbs and duplicate samples of three to five selected hairs with bulbs were used to extract DNA for further analysis. A 400 base pair fragment of the cytochrome b gene was amplified by polymerase chain reaction (PCR). We have experienced difficulty sequencing sample # 112203/6/DB and are in the process of doing an additional extraction. The PCR product from samples #112303/3/DB and #112603/6/DB were sequenced and a 382 base region was read and aligned against other rabbit cytochrome b sequences (see attached pages). Our comparative data base for cottontail cytochrome b sequences includes the consensus sequences from six eastern cottontails (Sylvilagus floridanus), five New England cottontails (S. transitionalis), a desert cottontail (S. auduboni), a swamp rabbit (S. aquaticus) and a domesticated rabbit (Oryctolagus cuniculus). The sequences from eastern cottontails include samples from a wide geographic range including Vermont. Some sites within the sequence are variable within a species (polymorphism or geographic variation) and are designated with either a Y (pyrimidine variation of either a C or a T) or a R (purine variation of either an A or a G). From the attached pages you will see that there are 29 diagnostic sites (marked in yellow) that differentiate the sequence of the eastern cottontail from the New England cottontail. Samples # 112303/3/DB and # 112603/6/DB have the eastern cottontail marker (base) at 28 of these 29 sites (see attached pages). The presence of a base (A) typical of the New England cottontail at position 330 should not be interpreted as introgression or hybridization between eastern and New England cottontails as the gene examined is in the mitochondrial genome and is non -recombining. The presence of an A at position 330 represents an additional polymorphism within the eastern cottontail that was missed in our data base of six S. floridanus. Note that samples # 112303/3/DB and # 112603/6/DB have the base (T) typical of eastern cottontails at site 165 (incorrectly identified as site 115 in the previous report) whereas sample # 112203/3/DB had the base (C) typical of a New England cottontail. These two samples differ from sample # 112203/3/DB by the base at position 330 discussed above and also differs from each other at site 33. !CI: Our genetic analysis of DNA extracted from hair samples # 112303/3/DB and # 112603/6/DB indicate that both of the rabbitrfrom which samples were collected are eastern cottontail (S. floridanus). The aligned sequence similarity with the consensus sequence of the eastern cottontail represents a 99.7% match for sample # 112303/3/DB and a 99.5% match for sample # 112603/6/DB. Results from the reanalysis of sample # 112203/6/DB are expected by the end of next week. 0 . QIL-- - C. William Kilpatrick Comparison of cytochrome b sequences of 112303/3/DB and 112603/6/DB with consensus sequences of several species of leporids. 50 Mus ATGACAAACATACGAAAAACACACCCATTATTTAAAATTATTAACCACTC S.flor TATTAAAAATTGTAAACCATTC 112303/3 TATTAAAAATTGTAAACCATTC 112603/6 TATTAGAAATTGTCAACCATTC S.tran TATTAAAAATTGYAAACCATC Saudob TACTAAAAATCATCAACCACTC Saquat TAC????AATCGTCAACCACTC Orcyto TATTAAAAATTGTTAACCACTC 100 Mus ATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTG S.flor TCTAATTGACCTCCCYGCACCATCAAACATYTCYRCCTGATGAAACTTCG 112303/3 TCTAATTGACCTCCCTGCACCATCAAACATCTCTGCCTGATGAAACTTCG 112603/6 TCTAATTGACCTCCCTGCACCATCAAACATCTCTGCCTGATGAAACTTCG S.tran OCTAATNGACCTCCCTACOCCATCAAACATCTCTGCCTGATGAAACTTCG Saudob CTTAATTGACCTTCCCACCCCATCAAACATCTCTGCCTGATGAAACTTCG Saquat TCTAATTGACCTTCCCACCCCATCAAATATCTCTGCCTGATGAAACTTCG Orcyto CCTAATTGACCTTCCTGCTCCATCAAACATCTCTGCCTGATGAAACTTTG 150 Mus GGTCCCTTCTAGGAGTCTGCCTAATACTCCAAATCATTACAGGTCTTTTC S.flor GATCTCTTCTAGGCCTATGCCTAATAATTCAAATCCTAACCGGCCTRTTC 112303/3 GATCTCTTCTAGGCCTATGCCTAATAATTCAAATCCTAACCGGCCTGTTC 112603/6 GATCTCTTCTAGGCCTATGCCTAATAATTCAAATCCTAACCGGCCTGTTC S.tran GATCMCTOCTAGGCCTOTGCCTAITAATTCAAATCCTAACCGGCCTATTC Saudob GGTCCCTCCTAGGCCTATGCCTAATCATTCAAATCCTAACCGGCCTATTC Saquat GATCCCTCCTAGGCCTATGCCTAATCATTCAAATCCTAACCGGCCTATTC Orcyto GCTCTCTACTAGGCCTGTGCCTTATAATTCAAATTTTCACTGGCCTATTC 200 Mus TTAGCCATACACTACACATCAGATACAATAACAGCCTTTTCATCAGTAAC S.flor TTAGCTATGCAYTATACCTCGGACACCCTCACAGCATTCTCATCAGTAAC 112303/3 TTAGCTATGCACTATACCTCGGACACCCTCACAGCATTCTCATCAGTAAC 112603/6 TTAGCTATGCACTATACCTCGGACACCCTCACAGCATTCTCATCAGTAAC S.tran TTAGCIATIICATTA.&ACCTCGGACAC#CTCACAGCATTCTCATCAGTAAC Saudob TTAGCCATGCACTACACCTCCGACACACTTACAGCCTTCTCGTCAGTAAC Saquat TTAGCCATGCACTACACCTCCGACACACTTACAGCATTCTCATCGGTAAC Orcyto TTAGCCATACACTACACCTCTGACACAACAACAGCATTCTCATCAGTAAC 250 Mus ACACATTTGTCGAGACGTAAATTACGGGTGACTAATCCGATATATACACG S.flor TCACATTTGCCGAGATGTAAACTAYGGCTGACTAATTCGTTATCTTCACG 112303/3 TCACATTTGCCGAGATGTAAACTACGGCTGACTAATTCGTTATCTTCACG 112603/6 TCACATTTGCCGAGATGTAAACTACGGCTGACTAATTCGTTATCTTCACG S.tran TCA AT TGCCGAGATGTAAACTACGGCTGACTAATTCGOTATCTYCACG Saudob TCATATTTGTCGAGACGTAAACTACGGCTGACTAATCCGATATCTTCATG Saquat TCATATTTGCCGAGACGTAAACTACGGCTGGCTAATTCGATACCTTCACG Orcyto CCATATTTGCCGAGATGTTAACTATGGCTGACTTATCCGATACCTCCACG 300 Mus CAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGA S.flor CTAATGGAGCATCAATATTCTTCATCTGCCTTTATATACAYGTCGGCCGC 112303/3 CTAATGGAGCATCAATATTCTTCATCTGCCTTTATATACACGTCGGCCGC 112603/6 CTAATGGAGCATCAATATTCTTCATCTGCCTTTATATACACGTCGGCCGC S.tran CTAAt:GGAGCATCOATATTCTTtATCTGCCTITATAT CATGTCGGCCGC Saudob CTAACGGAGCATCAATATTCTTCATCTGCCTTTACATACACGTCGGCCGC Saquat CTAACGGAGCATCAATGTTCTTCATCTGCCTCTATATGCACGTCGGCCGC Orcyto CTAACGGAGCATCTATATTCTTTATTTGCCTCTACATACACGTAGGCCGC 350 Mus GGCTTATATTATGGATCATATACATTTATAGAAACCTGAAACATTGGAGT S.flor GGCATTTACTATGGCTCCTACACTTACCTGGAAACCTGAAAYATTGGTAT 112303/3 GGCATTTACTATGGCTCCTACACTTACCTAGAAACCTGAAATATTGGTAT 112603/6 GGCATTTACTATGGCTCCTACACTTACCTGAAACCTGAAATATTGGTAT S.tran GGCATTTACTATGGCTCCTACACDTACCTGAAACCTGAAATATTGG0"AT Saudob GGTATTTACTACGGCTCCTACACTTACCTAGAAACCTGAAATATTGGCAT Saquat GGTATTTACTACGGCTCCTACACTTATCTAGAAACCTGAAATATTGGTAT Orcyto GGAATCTACTATGGATCATACACATACCTAGAGACCTGAAACATTGGCAT 400 Mus ACTTCTACTGTTCGCAGTCATAGCCACAGCATTTATAGGCTACGTCCTTCC S.flor TATCCTAYTATTCGCAGTGATAGCTACAGCATTCATAGGCTATGTACTCCC 112303/3 TATCCTATTATTCGCAGTGATAGCTACAGCATTCATAGGCTATGTACTCCC 112603/6 TATCCTATTATTCGCAGTGATAGCTACAGCATTCATAGGCTATGTACTCCC S.tran TATCCTOTTATTCGCAGTMTAGC ACAGCATTRATAGGCTAGGTACTCCC Saudob TATCCTGCTATTCGCAGTAATAGCCACAGCTTTCATAGGCTATGTACTCCC Saquat TATTCTACTATTTGCAGTAATAGCCACAGCTTTCATGGGCTATGTACTTCC Orcyto CATCCTCCTATTCGCAGTAATAGCCACAGCATTTATCGGTTATGTCCTCCC 450 Mus ATGAGGACAAATATCATTCTGAGGTGCCACAGTTATTACAAACCTCCTAT S.flor ATGAGGCCA 112303/3 ATGAGGACAAATATCATTCTG 112603/6 ATGAGGACAAATATCATTCTG S.tran ATGAGGCCA Saudob ATGAGGCCA Saquat ATGAGGCCA Orcyto ATGAGGACA Y = polymorphism for either C or T (pYrimidines) R = polymorphism for either G or A (puRines) jC Northeastern Wildlife Genetics December 20, 2003 Arrowwood Environmental 950 Bert White Rd. Huntington, VT 05462 A sample (# 112203/3/DB) of rabbit hair was received on November 24, 2003. Hairs were examined microscopically for the presence of hair bulbs and duplicate samples of three to five selected hairs with bulbs were used to extract DNA for further analysis. A 400 base pair fragment of the cytochrome b gene was amplified by polymerase chain reaction (PCR). The PCR product was sequenced and a 382 base region was read and aligned against other rabbit cytochrome b sequences (see attached pages). Our comparative data base for cottontail cytochrome b sequences includes the consensus sequences from six eastern cottontails (Sylvilagus floridanus), five New England cottontails (S. transitionalis), a desert cottontail (S. auduboni), a swamp rabbit (S. aquaticus) and a domesticated rabbit (Oryctolagus cuniculus). The sequences from eastern cottontails include samples from a wide geographic range including Vermont. Some sites within the sequence are variable within a species (polymorphism or geographic variation) and are designated with either a Y (pyrimidine variation of either a C or a T) or a R (purine variation of either an A or a G). From the attached pages you will see that there are 29 diagnostic sites (marked in yellow) that differentiate the sequence of the eastern cottontail from the New England cottontail. Sample # 112203/3/DB has the eastern cottontail marker (base) at 28 of these 29 sites (see attached pages). The presence of a base (C) typical of the New England cottontail at position 115 should not be interpreted as introgression or hybridization between eastern and New England cottontails as the gene examined is in the mitochondrial genome and is non -recombining. The presence of a C at position 115 represents additional polymorphism within the eastern cottontail that was missed in our data base of six S. floridanus. Our genetic analysis of DNA extracted from hairs in sample # 112203/3/DB indicate that the rabbit from which this sample was collected is an eastern cottontail (S. floridanus). The aligned sequence similarity represents a 99.7% match with the consensus sequence of the eastern cottontail. C. William Kilpatrick .;)t Comparison of cytochrome b sequence of 112203/3/DB with consensus sequences of several species of leporids. 50 Mus ATGACAAACATACGAAAAACACACCCATTATTTAAAATTATTAACCACTC S.flor TATTAAAAATTGTAAACCATTC 112203/3 AAAAATTGTAAACCATTC S.tran TATTAAAAATTGYAAACCACTC Saudob TACTAAAAATCATCAACCACTC Saquat TAC????AATCGTCAACCACTC Orcyto TATTAAAAATTGTTAACCACTC 100 Mus ATTCATTGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTG S.flor TCTAATTGACCTCCCYGCACCATCAAACATYTCYRCCTGATGAAACTTCG 112203/3 TCTAATTGACCTCCCTGCACCATCAAACATCTCTGCCTGATGAAACTTCG S.tran CCTAATCGACCTCCCT C_ICCATCAAACATCTCTGCCTGATGAAACTTCG Saudob CTTAATTGACCTTCCCACCCCATCAAACATCTCTGCCTGATGAAACTTCG Saquat TCTAATTGACCTTCCCACCCCATCAAATATCTCTGCCTGATGAAACTTCG Orcyto CCTAATTGACCTTCCTGCTCCATCAAACATCTCTGCCTGATGAAACTTTG 150 Mus GGTCCCTTCTAGGAGTCTGCCTAATACTCCAAATCATTACAGGTCTTTTC S.flor GATCTCTTCTAGGCCTATGCCTAATAATTCAAATCCTAACCGGCCTRTTC 112203/3 GATCTCTTCTAGGCCTATGCCTAATAATTCAAATCCTGACCGGCCTGTTC S.tran GATC CTCCTAGGCCTGTGCCTA TAATTCAAATCCTAACCGGCCTATTC Saudob GGTCCCTCCTAGGCCTATGCCTAATCATTCAAATCCTAACCGGCCTATTC Saquat GATCCCTCCTAGGCCTATGCCTAATCATTCAAATCCTAACCGGCCTATTC Orcyto GCTCTCTACTAGGCCTGTGCCTTATAATTCAAATTTTCACTGGCCTATTC 200 Mus TTAGCCATACACTACACATCAGATACAATAACAGCCTTTTCATCAGTAAC S.flor TTAGCTATGCAYTATACCTCGGACACCCTCACAGCATTCTCATCAGTAAC 112203/3 TTAGCTATGCACTA ACCTCGGACACCCTCACAGCATTCTCATCAGTAAC S.tran TTAGC ATr_CATTA ACCTCGGACAC_.CTCACAGCATTCTCATCAGTAAC Saudob TTAGCCATGCACTACACCTCCGACACACTTACAGCCTTCTCGTCAGTAAC Saquat TTAGCCATGCACTACACCTCCGACACACTTACAGCATTCTCATCGGTAAC Orcyto TTAGCCATACACTACACCTCTGACACAACAACAGCATTCTCATCAGTAAC 250 Mus ACACATTTGTCGAGACGTAAATTACGGGTGACTAATCCGATATATACACG S.flor TCACATTTGCCGAGATGTAAACTAYGGCTGACTAATTCGTTATCTTCACG 112203/3 TCACATTTGCCGAGATGTAAACTACGGCTGACTAATTCGTTATCTTCACG S.tran TCA AT TGCCGAGATGTAAACTACGGCTGACTAATTCG"TATCTYCACG Saudob TCATATTTGTCGAGACGTAAACTACGGCTGACTAATCCGATATCTTCATG Saquat TCATATTTGCCGAGACGTAAACTACGGCTGGCTAATTCGATACCTTCACG Orcyto CCATATTTGCCGAGATGTTAACTATGGCTGACTTATCCGATACCTCCACG 300 Mus CAAACGGAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGA S.flor CTAATGGAGCATCAATATTCTTCATCTGCCTTTATATACAYGTCGGCCGC 112203/3 CTAATGGAGCATCAATATTCTTCATCTGCCTTTATTTACACGTCGGCCGC S.tran CTAA GGAGCATC ATATTCTT ATCTGCCT TATAT CATGTCGGCCGC Saudob CTAACGGAGCATCAATATTCTTCATCTGCCTTTACATACACGTCGGCCGC Saquat CTAACGGAGCATCAATGTTCTTCATCTGCCTCTATATGCACGTCGGCCGC Orcyto CTAACGGAGCATCTATATTCTTTATTTGCCTCTACATACACGTAGGCCGC 350 Mus GGCTTATATTATGGATCATATACATTTATAGAAACCTGAAACATTGGAGT S.flor GGCATTTACTATGGCTCCTACACTTACCTGGAAACCTGAAAYATTGGTAT 112203/3 GGTATTTACTATGGCTCCTACACTTACCTGGAAACCTGAAATATTGGTAT S.tran GGCATTTACTATGGCTCCTACAC TACCT GAAACCTGAAATATTGG AT Saudob GGTATTTACTACGGCTCCTACACTTACCTAGAAACCTGAAATATTGGCAT Saquat GGTATTTACTACGGCTCCTACACTTATCTAGAAACCTGAAATATTGGTAT Orcyto GGAATCTACTATGGATCATACACATACCTAGAGACCTGAAACATTGGCAT 400 Mus ACTTCTACTGTTCGCAGTCATAGCCACAGCATTTATAGGCTACGTCCTTCC S.flor TATCCTAYTATTCGCAGTGATAGCTACAGCATTCATAGGCTATGTACTCCC 112203/3 TATCCTATTATTCGCAGTGATAGCTACAGCATTCATAGGCTATGTACTCCC S.tran TATCCT TTATTCGCAGT ATAGC ACAGCATT ATAGGCTA GTACTCCC Saudob TATCCTGCTATTCGCAGTAATAGCCACAGCTTTCATAGGCTATGTACTCCC Saquat TATTCTACTATTTGCAGTAATAGCCACAGCTTTCATGGGCTATGTACTTCC Orcyto CATCCTCCTATTCGCAGTAATAGCCACAGCATTTATCGGTTATGTCCTCCC 450 Mus ATGAGGACAAATATCATTCTGAGGTGCCACAGTTATTACAAACCTCCTAT S.flor ATGAGGCCA 112203/3 ATGAGGACA S.tran ATGAGGCCA Saudob ATGAGGCCA Saquat ATGAGGCCA Orcyto ATGAGGACA Y = polymorphism for either C or T (pYrimidines) R = polymorphism for either G or A (puRines) State Of Vermont Department of Fish and Wildlife Department of Forests, Parks and Recreation Department of Envirohmental Conservation State Geologist RELAY SERVICE FOR THE HEARING IMPAIRED 1-800-253-0191 . TDD>Voice 1-800-253-0195 Voice>TDD ROUTING i N E?.AL _.�Nn,ED DATE AGENCY OF NATURAL RESOURCES partment of Environmental Conservation WATER QUALITY DIVISION 103 South Main Street Building 10 North Waterbury, VT 05671-0408 FAX 802-241-3287 TEL 802-241-3770 January 27, 2004 Art Gilman and Errol Briggs William D. Countryman Ass RD 1, Box 999 Northfield, Vermont 05663 SUSPENDED Re: South Village, Spear Street, South Burlington, Wetlands Project #2001-274 Dear Art and Errol: Thank you for meeting with us this month to discuss the project your client (Retrovest) is in the process of planning for the above 'captioned property. While we have not seen any proposed plans for the project, we understand that your client will be presenting a concept plan to the City of South Burlington shortly. At this time we are providing you with some general comments that we hope can be incorporated into the concept plan. We have been aware of this project for a few years. In 2001, representatives from several different programs in the Agency (me and John Austin, Jodi Shippee of the Natural Heritage Program, and Kim Greenwood, Erosion Control Specialist) had the opportunity to visit this site with Retrovest representatives. Retrovest was interested in acquiring the property at that time, and was soliciting comments on natural resource issues at the site. After the site visit, several Agency staff met to discuss. the parcel. These Agency .staff made the following recommendations: 1) that any development on the parcel be clustered along the front of the property, so that the two large wetland complexes on the site could be retained and protected from development and 2) the plan be designed to avoid crossing either of these wetlands. The reasoning for these recommendations is described below. During our site visit we observed two large Class Two wetland complexes. One is in the center of the property and runs north -south (this will be referred to as the "center wetland") and the other is located along the eastern boundary of the site (the "eastern wetland"). Both of these wetlands are protected by the Vermont Wetland Rules. Please note that any activity in a Class Two wetland, or its associated 50-foot buffer zone, other than the allowed uses specified in Section 6.2 of the Vermont Wetland Rules, requires a Conditional Use Determination (CUD) from the Agency of Natural Resources. According to Section 8.5 of the Vermont Wetland Rules, a CUD can only be issued if it is determined that the use will have no undue adverse impact on protected functions, unless. such impacts are nutigated. Mitigation measures include avoidance and minimization of wetland impacts. Both of these wetlands are significant for several functions and values including wildlife habitat, water quality protection, flood storage, and erosion control. The eastern wetland is Regional Offices - Barre/Essex Jct. /Pittsford/Rutland!Spririg fie] d!St. Johnsbury Art Gilman and Errol Briggs Page 2 also significant for the hydrophytic vegetation function. These wetlands are both located in an impaired watershed. Therefore, maintenance of the existing water quality fiinction of these wetlands is critical, both during and after construction. The project should be planned to avoid impacts to these valuable wetland resources, and to maintain the integrity of the buffer zones. The best erosion prevention occurs during the planning stages of a project. This includes avoiding areas that are likely to erode, providing adequate riparian (that is, stream and wetland) buffers, and designing the project construction with the least amount of impact to water resources as possible. This also helps to maintain the hydrology of the site, an important consideration in not causing erosion problems as a result of altered water flows. It should be noted that this project will require authorization to discharge under the Construction General Permit 3-9001 (2003). Authorization under the general permit can not be granted until the CUD has been issued for wetland and wetland buffer impacts. Based on our meeting last week, we understand that your client is proposing an approximately 300-unit housing development on this property. We are concerned that the construction of a dense housing development .will adversely impact the wetland -dependant wildlife that currently depend on the habitat associated with this site. Based on our observations and those of your representatives, these wetlands are important for waterfowl, wading birds, a myriad of songbirds, raptors including northern harriers, wetland -dependant forbearers such as mink and otter and other wildlife. Therefore, we recommend that the units be concentrated away from these wetlands. During the Act 250 review process we will recommend a 300-foot buffer zone for both the center and the eastern wetland for wildlife. This buffer distance has been applied to other development projects in Chittenden County that involved wetlands with significant wildlife functions and values. We continue to recommend that the housing be concentrated in the front of the site. It appears there is ample space for a residential development in this area. While there are Class Three wetlands all along the front of the site, in our opinion these wetlands do not support as many functions as the center and eastern Class Two wetlands. Again, we appreciate being contacted for comments early in your planning process. Please send us a copy of any concept plans as they emerge so we can give you feedback on them. If you have any questions regarding this letter, feel free to contact any of us. Sincerely, April J. Mouldeft John Austin Kim Greenwood District Wetlands Ecologist District Wildlife Biologist Erosion Control Specialist cc: Julie Beth Hoover, City of South Burlington Planning and Zoning Peter Keibel, Act 250 Coordinator Mike Adams, Corps of Engineers Michelle Holgate, Retrovest " ��:.:'i ..„ill:..i..:�••• •; t t LEGEND ��• / Class II Wetlands _ - Streams notes: Wetland buffers are software generated by Arrowwood Environmental. Wetlands and Property lines from Retrovest Class III Wetlands ':. Pond I South Village plan dated 6128/04. Surface water from VCGI. Orthophotography from Vt. Mapping program. This map is 300' Class II Buffer Calkins Prop arty,\_. intended to depict locations of wetland delineation problem Development Proposal — — Property Lines \`Z areas identified by Arrowwood Environmental ecologists, errors may exist. Wetlands and Wildlife Study 0 900200 400 600 800 Calkins Property, South Burlington Vermont 1 inch equals 600 feet o , Attachment, Wetland Buffer Map ARRO WOOD ENVIRONMENTAL N t '• 950 BERTWHfTE ROAD HONTINGTON.VT OWI page 24 9/21 /04 (802) 434.7276 FAX (802) 434-2102 tic 7VIEMO South Burlington Planning & Zoning To: David Scheuer, Retro*Sroning mpanies From: Juli Beth Hinds, AIC Director of Planning RE: Invoice for Technical Review of Traffic Study South Village Date: March 16, 2005 Enclosed is Jon Dietrich's final invoice for his technical review of the South Village traffic study. We are pleased that we have finalized the Master Plan approval, and thank you and Rick Chellman for your very strong cooperation with the technical review process. Payment can be made directly to Fuss & O'Neill at the address on the invoice. Please give me a call with any questions. Remit to: 146 Hartford Road Manchester, CT 06040-5992 Tel 860 646-2469 Fax 860 643-6313 :3Fuss & ®'Neill Inc. Consulting Engineers South Burlington, VT Attn: Ms. Juli Beth Hinds Department of Planning and Zoning 575 Dorset St. South Burlington VT 05403 Project: 20041008.A10 South Village Technical Review Assistanc Professional services through February 19, 2005 Task: 00100 Traffic Report Review Professional Personnel Other Offices: West Springfield, Massachusetts Trumbull, Connecticut Providence, Rhode Island Greenville, North Carolina Columbia, South Carolina Invoice March 10, 2005 Project No: 20041008.A10 Invoice No: 0096601 Hours Rate Amount Associate Dietrich, Jon 46.25 116.02 5,365.93 Senior Traffic Engineer II Savaria, Stephen 7.00 97.11 679.77 Totals 53.25 6,045.70 Total Labor 6,045.70 Reimbursable Expenses Employee Mileage 1/18/05 Dietrich, Jon 66 miles 26.73 1/19/05 Dietrich, Jon 66 miles 26.73 2/8/05 Dietrich, Jon 90 miles 36.45 2/9/05 Dietrich, Jon 90 miles 36.45 Total Reimbursables 126.36 126.36 Total this task $6,172.06 Total this invoice $6,172.06 Billings to date current Prior Total Labor 6,045.70 3,744.21 9,789.91 Expense 126.36 0.00 126.36 Totals 6,172.06 3,744.21 9,916.27 *Net 30 days -1.5% service charge on invoice balance over 30 days (18% per year) 1 II I 1 / -----ILI 1 I I i � I I ` I I I \ I 1 I 1 1 1 1 1 I , I I , 1 1 I I I 1 I I 1 I 1 1 1 1 / I 1 / 1 I I I I , I 1 1 I / I 1 1 1 II 1 I I II I 1 I I 1 '1 1 I Q1 '1 1 1 I II 1 1 I 1 / I I 1 r 1 I I I 1 I1 ' I 1 I 1 I 1 1 1 I I I 1 I I 1 I I 1 I 1 I 1 + I 1 1 I r I 1 _ I 1 I 1 I / I � I r 1 1 , 1 I I I I ao I 1 1 I , I 1 1 1 1 / 1 _I I 1 1 I )RUINSI — PLANS PREPARED BY: I r' CIVIL ENGINEERING ASSOCIATES. INC. P.O. BOX I85 SHELBURNE, V! 05W BOt-0B = FAX' A02-9BS , —& —,-- a APPLIED APPLIED ECOLOGICAL CONSULTANTS i i jDRAIN ACL PAFKINO � CNECI® % i DSM R7-5 / % APPAO� DSM STA TO % STA APPLICANT: SOUTH VILLAGE COMMUNITIES, LLC. STA. �. STA-i PROJECT CONSULTANTS: STA. TO f7l. STA LAND USE PLANNER/ARCHITECT No PpCNO earl PAFKINO // / l LOONEY RICKS KISS NASHVILLE, TN BETWEENA ` SKM If ~ CML ENGINEER sra 7-2 Tp R7-5 j CIVIL ENGINEERING ASSOCIATES STA STA. TO i SHELBURNE, VT 1 R7-2o \ T-� I TRAFFIC ENGINEER j STA STA To i_ \ I _ /� --- ---—--------'-------'—'—'-----'---'---'—--— — — — ---� TND ENGINEERING i Illll�plli I oSSIPEE, NH i i i j I IIIII111111 _ _ LANDSCAPE ARCHITECT _ LAND -WORKS No to I MIDDLEBURY, VT PARCH PARKINQTM I I I I F CCF14B IiTE SWEET j rib I PROJECT TITLE: I I l�l R7-2a PARKNO STA. TO R7-2o STA TO PlFfff I I R7-2a STA. TO BETWEEN I 8KY�3 _ � � soY ILLA E PAFKNO i STA STA. i STA I 1-1. •...te..At.«... 4... .«t TF� BDE OF I I I R7-2o i I I srf�T STA 7-5T0 I — L---� — j STA STA. TO SPEAR STREET AND PARKNO R7-2o STA. I ALLEN ROAD I STA To I L— — — —� —�— — --"--- j — — ST A HIR�f I I — — — — --BETA--l�lNE Q SOUTH BURLINGTON, VT i R7-2o STA. TO I i STA. 10 �1 j BETWEEN SKINS 1�11 BEZ R7-2o j PAFKNO I STA. I — I I I STA. A I I I I I I R7-5 I STA I I STA- I A I~ 0+ 00 a oArz Lmect¢o AEvistoN I � i i I — i PAWNO STRIPING AND i IBETWEEN SIGNS ; -► PARCM � WE OF EZ I PAID j R7_za To TA-Sr"c �� SIGNAGE I STF$f R7-2° I PARKNO I 7:15 8rRfff I j PLAN j STA. TO i STA I I R7-2o I I 7-5TO STA TO I i STA STA- STA = i oA>•E FEB, 2005 nw•wc NUYAOt I II -------------- -------LT, j � � 40. _ ANE- ------------ -- 01243 I / I N0 / PLANS PREPARED BY: FARKk NO BETWEL I I PAFi(NG I I F O j BBIA i R7- ° I %/ 1 CORNER I PARKING I � STA TO I I STA. R7-2o P / CIYIL ENGINEERING ASSOCIATES. INC. I STA. TO STA r}�g BBIN P.O. BO%485 SHELBURNE. K 05482 I 1 I I STET STA 7-5TO I PAFJCW % / eoae = Far: a .S-an � PAPoCNO % /lilt ST i BETWEEN / APPLIED ECOLOGICAL. CONSULTANTS 1 ST TO I STA TO ~ I nx T. IIIIII IIIII STA. sra 7-2 T/ 1 I I T. _ STA. To / � ACL 1 I _T—.— -- I = / PAWING cxecoo I 1 I R7-5 I PARINO NG DSM — STA.ST TO I T7-� I = �_� \ ` .rrtovto 1 I I SIDE OF I / R7-5 DSM STREET I STA TO I R7-2o I Ip \ / STA APPLICANT: I I STA. TO I 1 PARKINCI STATM / / �r1IIIIIIII/II f I I iSDE OFi ��/ SOUTH VILLAGE I ,� i �O 00 _ �i STA. To I ` / COMMUNITIESF LLC. I I I II P STA. THS cb II STREET I ` ''''l/lllllll,Ill"II„` PROJECT CONSULTANTS: i FI R7-2° I j FI I STA TO I � PAWING m i STA LAND USE PLANNER/ARCHITECT LOONEY RICKS KISS 1 j j R7-2° NASHVILLE, TN co STA TO STA. CIVIL ENGINEER — PAFVJNQ— — Wjl CIVIL ENGINEERING ASSOCIATES NE — I R7-2o I TRAFFIC ENGINEER srASTA To — — �I� TND ENGINEERING f_ANEj OSSFPEE, NH -- -.--- - - DTI //// PARKING LANDSCAPE ARCHITECT /�— LAND -WORKS I I COFf� I I PAWCNO I _L� �C — _ I STA 7-5T0 MIDCLEBURY, VI' NDj _ 1 R7-2° I PAWING I i — 7 STA. `��` PROJECT TITLE: I I I J STA. TO I 7HS R7-5 i / ♦`` I STA. I SIF'iffSIDE T I PAPoC�OF STA. TO j / ♦, SOUTH 7 �r 1 I SIDE OF STA. i 10 / I R7-2o STREET STA. TO I _ KO I 1 — _.—"—.—__ I STA. R7-2° PAWCNG I PART NO aOE OF 1 — — — SIDE OF -_----- ----- -- STA. STA. TO F i 7Fi8 I SiFiE£T / SPEAR STREET AND 1 •�_ I STREET STA.STA_ 7-2T0 - ALLEN ROAD R7- I 1 R7-2° ``` / 1 TO I --To -o SOUTH BURLINGTON, VT STA. 1 \ \ 5T7c � I \ \ STA_I STA. �Iq N) PARKI NG \ BETWEEN /. SKM BETWEEN I acINs I -0. �1 .\ 111111 —'— 4 R7-2o I R7-2° PARKNG I \ \. \ Ilttl — / STA.TO STA. STA TO / STA. KD PAFVJNQ \ \ ' I R7-5 BETWEEN STA. TO SKINS _ STA. I L I / PAFfU R7-2o KiI /. 1 / T a I 1 PAFiIIJG / R7-5 o.rt "ECMQenswx I STA. TO J /i STA/• sro-l/l//11111111 v .y Of l / ; 1 STRIPING AND SIGNAGE )`Q \` ��. PLAN 1 , _ /� PARKNG _ \ v'V/� JQ � �VV I TO ID _ CCH'Si PARKNG _ ` -'. __ � \'\ n•ra nwnwc xureex Q R7-2o BFJEOF — _ _ _ _ _ _ FEB, 2005 h�/ STA. TO SAfiEEf _ _ _ STA. —.---- — scut `�� R7-2° _ r��, 5TA rG -.___._ ,� - �� C-4.12 STA. j' eta. x°. `�� 01243 A -W i South Village Traffic Impact Study April, 2004 I Traffic Impact Study "South Village" Proposal: Mixed -Use; Residential, Agricultural & Educational ISpear Street and Allen Road South Burlington, Vermont I April 16, 2004 Prepared for: Mr. David Scheuer, President The RetroVest Companies 70 South Winooski Avenue Burlington, Vt. 05401-3830 Prepared by TND Engineering Chester Chellman, P.E. 1270 Route 16 PO Box 388 Ossipee, NH 03864-0440 Telephone 603.539.5999 Fax 603.539.7912 email chellmanOUNDEngineerin-g.com Page 2 I Table Of Contents South Village EXECUTIVE SUMMARY Level of Service Analysis INTRODUCTION Existing Conditions Spear Street Allen Road, Barstow Road and Dorset Street Shelburne Road/ US Route 7 Data Collection TRIP GENERATION Analysis Calculations AM Design Hour Project Traffic (1) AM Design Hour Project Traffic (2) PM Design Hour Project Traffic (1) PM Design Hour Project Traffic (2) ACCIDENT ANALYSIS Conclusions And Recommendations Summaries of Levels of Service Proposed Project Intersection Left Turn Lane Warrant Mitigation of Impacts Technical Appendix South Village Traffic Impact Stud) April, 2004 1 4 5 5 6 7 7 x 11 12 14 15 16 17 18 19 20 20 22 23 24 27 Page 3 South Village Traffic Impact Study April, 2004 EXECUTIVE SUMMARY The proposed Project is a mixed -use community located on Spear Street in South Burlington, Vermont. The residential components will include a mix of single family homes, apartments, townhouses and condominium units and total to approximately 332 units. A school of 100 students was also included in this analysis. The proposed project is anticipated to commence construction this year. The Project proposes three access points on Spear Street: one at the intersection of Allen Road, one at the Northerly limits of the Project and another near the Southerly limits of the Project. The Project will also provide a connection to Midland Avenue which in turn connects with Dorset Street. Future Traffic Volumes In order to estimate future A.M. and P.M. peak hour traffic volumes, a growth factor of one percent per year was used for this study. This growth factor was agreed upon by the City of South Burlington, CCMPO, and the VAOT staff for the recent Quarry Hill Subdivision Traffic Impact Study.' Existing (2003) A.M. and P.M. design hour traffic volumes were then projected to year 2008 and 2013 conditions using the growth factor accordingly. The traffic generated by background developments was then added to 2008 and 2013 volumes to develop 2008 and 2013 No Build Traffic Volumes. ' As requested by the City of South Burlington Planning Department, design assumptions and study periods were selected to match with those in the Quarry Hill Subdivision Traffic Impact Study dated October, 2003. Page 4 South Village Traffic Impact Study April, 2004 For the purposes of this study, and in accordance with discussions and agreement with the Metropolitan Planning Organization reached in 2002, 95% of the Project's vehicular traffic has been assumed to travel to and from Spear Street. The remaining 5% is assumed to travel East along Midland Avenue to and from Dorset Street. A total of 377 vehicle trips (115 in/262 out) are generated by the proposed development during the A.M. peak hour period. During the P.M. peak hour period, a total of 467 vehicle trips (283 in/184 out) are generated by the proposed development. Approximately 60% of site traffic is headed to or coming from the North on Spear Street, while 20% is Westerly oriented along Allen Road and 15% Southerly oriented along Spear Street. As discussed above, the remaining 5% is Easterly oriented. Level of Service Analysis Traffic analysis for this study was based on the 2000 Highway Capacity Manual and conducted using Synchro and SimTraffic Software. Level of service was determined for the study area intersections under future 2008 and 2013 No Build and Build traffic volume conditions during the A.M. and P.M. peak hour conditions. Signal timings for the Spear' Street/Swift Street intersections were provided by Fuss & O'Neill Consulting Engineers, retained by the City of South Burlington. Signal data for the signal at Allen Road/Shelburne Road/Route 7 was provided by the Vermont Agency of Transportation, Traffic Design Section. Future conditions at Allen Road/Shelburne Road/Route 7 were based on updated signal information provided by the signal installer. INTRODUCTION TND Engineering (TND) has prepared this traffic impact and access study for a proposed mixed use community located primarily on Spear Street in South Burlington, Vermont. Page 5 South Village Traffic Impact Study April, 2004 The project is expected to be commenced and occupied in 2004. Two design years were chosen: • 2004 (opening year) • 2008 (opening year plus 4 years [to match the Quarry Hill analysis]) • 2013 (opening year plus nine years [to match the Quarry Hill analysis]) The study area involved the intersections of: • Spear Street and Allen Road; • Spear Street and Swift Street; • Allen Road and Route 7/Shelburne Road; • Spear Street and Barstow Road; and • Barstow and Dorset at Cheese Factory Road IN USSRI A! LYDNS +\ ENWOOD SWIFT wen Prh EWER RXW y UR LA EL INIt, a ( -C10 r MCI TO IN YR E P.1... SARTL TT pY RD on..W.WF My K C 'EDAP. O N N rs Q w � W 17 Q u> RD Site `" y4 14ARrlItOA`ERE, F.L -EVI.E .. t OAK HILL RD. G,L�A AT, RD JUNIPER ROO ;'WODOBI'HE RO ] 4 pZAJ hC Q BAR3Tp y RI) w 1 0 P{ x o w. Existing Conditions OLD R LN Evaluation of existing conditions within this project area included the review and Development of transportation -system geometry and traffic control, land use, existing traffic ✓olumes, accident data and sight distance. Page 6 South Village Traffic Impact Stud) April, 2004 Spear Street Spear Street is a two-way two lane north -south roadway abutting the project site. The posted speed limit on Spear Street is 35 miles per hour. Spear Street terminates at the Jughandle intersection with Williston Street and East. In the vicinity of the proposed Project land use along Spear Street is currently residential, agricultural and open space, with other proposed residential developments currently in various stages of planning. Allen Road, Barstow Road and Dorset Street These are all two-way two lane roadways that are both east -west (Allen & Barstow) and north -south (Dorset). Allen Road intersects with Spear Street opposite the primary proposed entrance to the Project Shelburne Road/ US Route 7 Quoting from its website(http://www.us7shelburneroad.com/): U.S. Route 7, also known as Shelburne Road, serves as the southern gateway to Chittenden County. The Vermont Agency of Transportation (VTrans) is at work to improve a portion of U.S. Route 7 which will be extended 3 miles from Imperial Drive in South Burlington to the recently completed LaPlatte River Crossing in Shelburne. The result will be a landscaped four -lane boulevard, with a planted median island, bike lanes, sidewalks, bus stops and shelters, street lighting and a coordinated signal system. These features have the ability to reduce congestion and improve mobility while providing for the needs of bicyclists and pedestrians. Median u-turn breaks will be provided at five locations. This $32 million project will be constructed in three segments. The first segment, the LaPlatte River Crossing at the southern end is completed. The northern or South Burlington segment will begin at Imperial Drive (just north of IDX Drive) in South Burlington and extend southward one mile to the South Burlington/Shelburne town line near Pine Haven Shores Road. The southern Page 7 South Village Traffic Impact Study April, 2004 or Shelburne segment will begin at the town line and extend over two miles south to Webster Road in Shelburne. Again, according to the website, the reconstruction past Allen Road should be completed by Fall. 2005. The future cross section includes 4 through lanes, with 6-foot bicycle lanes and a 14-foot center median with protected left turn lanes. In addition, the intersection with Allen Road is slated for reconstruction, but no additional lanes are proposed for Allen Road itself. Data Collection Manual turning counts were conducted by Civil Engineering Associates in January, 2004 for two hours during the weekday PM peak hours of 4 PM to 6 PM., and during the AM peak hours of 7 to 9 AM. These counts were then tabulated and analyzed to determine peak periods within each count and peak hour factors at each location. Peak hour factors, as is typical, were found to be more consistent in the PM peak hour (AM peak hour factors ranged from 0.84 to 0.95, PM peak hour factors were 0.93 to 0.97, except for the Barstow/Spear intersection that was at 0.88 in both AM and PM peak hours); this tabulated "raw" count data appears in the Technical Appendix. Comparisons were then made between published AOT automatic traffic counts, the design hourly data contained in the Quarry Hill Study referenced above, and the Fuss & O'Neill design hourly data used in their ongoing Spear street corridor study. The one intersection common with all three data sets, Spear and Swift streets showed the manual counts to vary in turning movement distribution a great deal from the other studies, but total intersection volume was only approximately 2% higher than the Quarry Hill design hourly volumes in the PM and approximately 9% higher in the AM. However, the manual counts taken in January show much higher volumes of eastbound and much lower southbound volumes in the AM design hour, than those in the F & O preliminary Page 8 South Village Traffic Impact Study April, 2004 data.2 As noted above, Shelburne Road has been undergoing construction and as a result travel patterns have likely, at least temporarily, shifted. These differences are depicted in the Figure, "South Village 2003 Design Hour Comparisons" on the following page. The ACT furnished design hourly volume data for Route 7, Spear Street, Barstow Road and Swift Street, but the manual data exceeded each of these values and the AOT data was therefore rejected. The AOT "Redbook" has an automatic traffic counter on Route 7, 0.3 mile north of Webster Road (approximately 2.4 miles south of the Allen Road/Route 7/ Shelburne Road intersection). This counter shows a monthly conversion factor of 1.13 from January to design hourly volumes. Design hourly volumes were therefore calculated by factoring the manual data by 1.13. Z Fuss & O'Neill have relied on the CCMPO and other local sources for the traffic volumes in their preliminary reports, and these reports are- as noted- preliminary. Page 9 South Village Traffic Impact Study April, 2004 AM Swift St. PM 7 127 17 44 158 21 35 105 20 ..*] I L-00'. 8 55 45 62 69 85 38 111 75 Swift St. 100 363 46 113 360 93 60 190 80 �4j `-► L. 75 145 146 �— 255 405 230 130 128 27 -01 t ro- 195 325 160 310 342 82 122 565 77 U) 0 CD 38 36 60 359 201 180 ---► 372 388 205 South Village Design Hour 2003 Comparisons Nearest Intersection= Quarry Hill Study Middle= DHV's From January 2004 Counts Outer- F&O Preliminary Data 45 45 195 -165 113 169 r 170 144 30 -4-1 t ro- 175240150 201 159 121 121 356 125 CD CD TND Engineering April, 2004 Page 10 South Village Traffic Impact Study April, 2004 TRIP GENERATION Over the course of a weekday, 3,220 vehicle trips per day (half in and half out) are projected at the site driveways. During the weekday PM peak hour, a total of 345 vehicle trips are projected to and from the proposed uses, with an entering volume of 202 vehicles at the peak hour (vph) and an exiting volume of 143 vehicles. During the weekday AM peak hour, a total of 321 vehicle trips are projected to and from the proposed uses, with an entering volume of 101 vehicles at the peak hour and an exiting volume of 220 vehicles. These traffic volumes have been computed based on the Institute of Transportation Engineers' (ITE) published equations in the 7th Edition of Trip Generation. The ITE has also published pass -by factors and internal capture factors for somewhat similar projects, but no such reductions were calculated here due to the location and specific use mix of the proposed Project. Therefore, the trip generation rates and data are all based on the formulas in Trip Generation, without modification. South Village, however, has been designed to be a much more walkable neighborhood than are most subdivisions of recent development. It is therefore anticipated that the traffic' impacts calculated and analyzed in this report are conservative. Page 11 South Village Traffic Impact Study April, 2004 Analysis Signalized Intersections Level of Service (LOS) is used to rank traffic operation on various types of facilities based on traffic volumes and roadway capacity using a series of letter designations ranging from A to F. Generally, Level of Service A represents free flow conditions and Level of Service F represents forced flow or breakdown conditions. The LOS designation is generally accompanied by a unit of measure in seconds indicating the level of delay. The signalized methodology is based on factors including traffic volumes, green time for each movement, phasing, whether or not the signals are coordinated, truck traffic, and pedestrian activity. Average stopped delay per vehicle in seconds is used as the basis for evaluation in this LOS methodology. It should be noted that the levels of service for the signalized intersections in this study were calculated using actuated, uncoordinated timing plans (no optimization). The Levels of Service for the study intersections with stop controls, or "unsignalized intersections," were analyzed using the unsignalized intersection capacity method from the Highway Capacity Manual 2000. This method determines a level of service for each minor turning movement by estimating the level of average delay in seconds per vehicle. The movement with the highest level of delay is presented as the Worst Case Level of Service. Page 12 South Village Traffic Impact Study April, 2004 The study intersections were analyzed using methodologies from the Highway Capacity Manual 2000, Transportation Research Board, 2000. This source contains methodologies for various types of intersection control, all of which are related to a measurement of delay Intersection Level of Service Criteria LOS Unsignalized Intersections Signalized Intersections A Delay of 0 to 10 seconds. Gaps in traffic are readily available for Delay of 0 to 10 seconds. Most vehicles arrive during the drivers exiting the minor street. green phase, so do not stop at all, B Delay of 10 to 15 seconds. Gaps in traffic are somewhat less Delay of 10 to 20 seconds. More vehicles stop than with readily available than with LOS A, but no queuing occurs on the LOS A, but many drivers still do not have to stop. minor street. C Delay of 15 to 25 seconds. Acceptable gaps in traffic are less Delay of 20 to 35 seconds. The number of vehicles frequent, and drivers may approach while another vehicle is already stopping is significant, although many still pass through waiting to exit the side street. without stopping. D Delay of 25 to 35 seconds. There are fewer acceptable gaps in Delay of 35 to 55 seconds. The influence of congestion is traffic, and drivers may enter a queue of one or two vehicles on the noticeable, and most vehicles have to stop. side street. E Delay of 35 to 50 seconds. Few acceptable gaps in traffic are Delay of 55 to 80 seconds. Most, if not all, vehicles must available, and longer queues may form on the side street. stop and drivers consider the delay excessive. F Delay of more than 50 seconds. Drivers may wait for long periods Delay of more than 80 seconds. Vehicles may wait through before there is an acceptable gap in traffic for exiting the side more than one cycle to clear the intersection. streets, creating long queues. Reference: Highway Capacity Manual 2000, Transportation Research Board, 2000. _L _r • — uy� I lul I nu�,l ot-'U"Ji iva pui vt;t ttclu. i ne ranges oT aelay associated with the various levels of service are indicated in the table depicted here. All capacity analysis results summarized in this report are for design hourly volume, or DHV. The DHV is the traffic volume for the design hour (typically the 301h highest hour of the year). In addition to analysis using the 2000 Highway Capacity Manual's (HCM) methodology, multiple "runs", as they are termed, were completed using microscopic simulation software known as SimTraffic. Many agencies, including New Hampshire and California's Departments of Transportation recognize this analytical method, which creates an animated Page 13 South Village Traffic Impact Study April, 2004 simulation of traffic conditions. The HCM methods are universally recognized, but the simulations are often better predictors of conditions at unsignalized intersections. Calculations A network was created in Synchro and SimTrafficTM, Version 6, and analysis completed for the following conditions: • Existing 2003 no -build; • Future 2008 conditions with 1 % background traffic growth, no -build for the subject project; • Future 2008 build condition which adds the subject premises traffic to the future traffic volumes • Future 2013 conditions with 1 % background traffic growth, no -build for the subject project; • Future 2013 build condition which adds the subject premises traffic to the future traffic volumes. All analysis was completed in accordance with applicable sections of the Vermont Agency of Transportation's (AOT) Guidelines for Traffic Engineering Issues, revised through August, 1995 and the AOT's Traffic Impact Evaluation, Study and Review Guide, January 2003. Project generated traffic at each of the five study intersections, in both the AM and PM design hours appear on the following pages. Page 14 60 I 8 9649 Allen Rd •11L-► 44 0 20 19 —� —�-► 1 3 L► South Village Traffic Impact Study tApril, 2004 132 21 North Drive 12 r 1 i so .-- zs 24 Site -,tr 7227 South Village AM Design Hour Project Traffic Turning Movements Page 15 i 29 r 5 r 8 33 t5 South Drive TND Engineering April, 2004 South Village Traffic Impact Study April, 2004 .01 .-- 3 Barstow Rd 2 5 �, 1 1 0 m W m m m 81 L► +— 26 j— 18 t r 30 12 24 Cheese Factory Swift St. 17 -� 55 62 15 07 cD v 07 Allen Road W _0 cD v 25 8 lh l.. 1-4 t r 11 South Village AM Design Hour Project Traffic Turning Movements M Barstow Rd TND Engineering April, 2004 Page 16 Allen Rd 29 40 --o- 121 I 20 5 2479 67 13 19 8 t 31 1 11 1019 27 15 4 r 5 South Village PM Design Hour 21 1t Project Traffic 30 Turning Movements I Page 17 South Village Traffic Impact Study April, 2004 North Drive Site South Drive South Village Traffic Impact Study April, 2004 1 �l�► .- 5 Barstow Rd 2 �, 1 0 0 -1 Cn cD 07 20 t 0 r 20 48 Cheese � I F t Swift St. Allen Road ac ory —1 ntr 53 --i, 36 28 22 m v 07 South Village PM Design Hour Project Traffic i Turning Movements f Page 18 07 m v 15 6 lh L '!— 7 Barstow Rd t r 23 TND Engineering April, 2004 South Village Traffic Impact Study April, 2004 ACCIDENT ANALYSIS Crash data was requested from the VAOT and the City of South Burlington police department for the most recent five year period. The City recently changed computer systems, such that researching crash data before the summer of 2003 has become less computer -based and more difficult to research. The town of Shelburne police department has also been contacted, but they have yet to respond regarding data for Barstow Road. The Quarry Hill Traffic Impact Study referenced earlier identified the Spear Street, Swift Street intersection as a high accident location, and this data is summarized below. Five -Year Accident History (1998-2002) —Segment and Intersection Locations Roadway Number of Accidents by Year 1998 1999 2000 2001 2002 Total Spear Street Spear Street/Swift Street intersection 6 5 9 9 9 38 Source: Table 8, Draft Quarry Hill Subdivision Traffic Impact Study, Wilbur Smith & Assoc. A telephone interview with the South Burlington police department determined that, in the time period from July 23, 2003 to April 15, 2004 there were two minor accidents and one property damage accident at the Spear Street and Allen Road intersection. This equates to a rate of approximately 0.8 accidents/million vehicles. This rate does not equate to a high accident location, but the data set represents a short a time frame. VAOT data, available online was reviewed for the period starting January 1997 to December 2001. Wilbur Smith & Associates obtained data from the City of South Burlington data for the period starting January 1998 to December 2002 The VAOT data indicated a total of 10 accidents along Spear Street between Main Street and just south of the Swift Street intersection during the five year period between 1997 and 2001. Of the 10 accidents, 4 were reported at the Spear Street/Swift Street intersection. Page 19 South Village Traffic Impact Study April, 2004 The Town of Shelburne has been contacted regarding both the Barstow Road/Spear Street and Barstow Road/Dorset Street intersections. Once this accident data has been received, a supplement to this report will follow. The Chittenden County Metropolitan Planning Organization and National Bureau of Transportation Statistics websites were reviewed, and no information was found indicating accident problems at study area intersections. The Route 7 corridor is identified as having higher accident experience, simply due to its volumes of traffic. However, since the one intersection on this highway (Allen Road) is being reconstructed, no analysis of prior history at that location seemed relevant. Conclusions And Recommendations The following tables summarize the HCM analysis for: current conditions; future 2008, and future 2013 no -build conditions (without the Project). Summaries of Levels of Service Existing Conditions Intersection: 1. Spear Street and Swift Street 2. Spear Street and Allen Road 3. Spear Street and Barstow Road 4. Barstow and Dorset at Cheese Factory Road 5. Allen Road and Route 7/Shelburne Road Existing 2004- No Build AM Delay LOS PM Delay LOS 21.6 C 11.5 B 39.1 E 21.9 C 34.1 D 42.5 E 15.3 C 11.9 B 14.9 B 11.2 B Page 20 South Village Traffic Impact Study April, 2004 Future 2008- No Build Future Conditions AM PM Intersection: Delay LOS Delay LOS 1. Spear Street and Swift Street 29.3 C 19.4 B 2. Spear Street and Allen Road 46.7 E 24.3 C 3. Spear Street and Barstow Road 40.9 D 52.8 F 4. Barstow and Dorset at Cheese Factory Road 16.8 C 12.4 B 5. Allen Road and Route 7/Shelburne Road 7.5 A 6.8 A Future 2013- No Build Future Conditions AM PM Intersection: Delay LOS Delay LOS 1. Spear Street and Swift Street 31.1 C 20.4 C 2. Spear Street and Allen Road 60.3 F 28.2 D 3. Spear Street and Barstow Road 53.4 F 72.2 F 4. Barstow and Dorset at Cheese Factory Road 19.1 C 13.2 B 5. Allen Road and Route 7/Shelburne Road 8.6 A 7.1 A These tables summarize future 2008 and 2013 conditions Build (with the {Project). Future 2008- Build Future Conditions AM PM Intersection: Delay LOS Delay LOS 1. Spear Street and Swift Street 40.2 D 21.4 C 2. Spear Street and Allen Road 11.8 B 13.3 B 3. Spear Street and Barstow Road 48.7 E* 66.7 F* 4. Barstow and Dorset at Cheese Factory Road 17.3 C 12.6 B 5. Allen Road and Route 7/Shelburne Road 8.6 A 6.9 A -bee text regarding mlcrosimulation results Page 21 South Village Traffic Impact Study April, 2004 Future Conditions Intersection: Future 2013- Build AM PM Delay LOS Delay LOS 1. Spear Street and Swift Street 2. Spear Street and Allen Road 3. Spear Street and Barstow Road 4. Barstow and Dorset at Cheese Factory Road 5. Allen Road and Route 7/Shelburne Road 47.5 D 25.6 C 12.1 B 13.6 B 66.0 F* 95.5 F* 19.7 C 13.4 B 9.7 A 7.5 A ocC ICJU 1CycUullly finuroslmulatlon results As can be seen above, all of the intersections operate acceptably at LOS D or better under current conditions, except Allen Road at Spear in the AM and Barstow at Spear in the PM, both of which are presently at LOS E. In the future scenarios analyses without the Project, all intersections continue to function acceptably except the same two intersections of Allen Road at Spear and Barstow at Spear, where the latter intersection degrades to a LOS F in 2008 PM and both degrade to LOS F in 2013, without the Project. It is noted that the northbound left at Swift and Spear operate at LOS F in the AM in 2008, while in 2013 the westbound through movement operates at LOS E and the northbound left continues to operate at LOS F. It is recognized that the City has undertaken a new Spear Street corridor study, and changes to the Swift/Spear intersection are being considered. Proposed Project Intersection The proposed central Project access at Spear and Allen Road exceeds the thresholds for peak hour signal Warrants (Warrant 3) under all future build conditions. Given the nature of the traffic flows along Spear Street, Warrant 8 for "Roadway Network" is also met as it will Page 22 South Village Traffic Impact Stud April, 2004 "encourage concentration and organization of traffic flow" along Spear 3. The entering volumes will also have more than 1000 entering vehicles during the AM and PM design periods. The HCM analysis shows that installing this signal will improve the level of service at the intersection itself to an LOS of B, for both 2008 and 2013 conditions. The signal will also create breaks in the flow of traffic, so that both the Barstow/Spear intersection, as well as other driveways along Spear Street will have additional opportunities to enter onto and turn from Spear Street. This also shows in the SimTraffic analysis, which shows the Barstow Road/ Spear Street intersection as performing much better than the HCM methodology predicts. Future Analysis Conditions Comparisons Spear/Barstow Intersection 2008 Spear Street and Barstow Road HCM 2008 Spear Street and Barstow Road SimTraffic 2013 Spear Street and Barstow Road HCM 2013 Spear Street and Barstow Road SimTraffic Left Turn Lane Warrant Future - Build AM PM Delay LOS Delay LOS 48.7 E 66.7 F 23.8 C 18.1 C 36.0 F 95.5 F 23.9 C 31.0 D Left turn lane warrant analysis was completed as well, with the results tabulated here. A left turn lane at the main site entrance is warranted under all future conditions. 3 Manual on Uniform Traffic Control Devices, 2003 Edition, page 4C-9. Page 23 South Village Traffic Impact Study April, 2004 Left Turn Lane Analysis at Allen Road Time Period left turns (SB) Advancing Vol (Spear SB) Opposing (Spear NB) Left Turn Lane Warranted 2008 AM 13% 381 555 Yes 2008 PM 10% 771 339 Yes 2013 AM 12% 397 807 Yes 2013 PM 10% 802 351 Yes The other two site drives will not have high enough left turning volumes to warrant left turn lanes (left turning volumes range from 2% to 3%). With the main entrance having a left turn lane and a traffic signal, the majority of left -tuning south bound -to -Project traffic will use the central entrance at Allen Road. Right turn lane warrants were also considered, but the highest volume of right -turning vehicles (2008 PM) is only 5.6%, and no right turn lane warrants are met by the Project. Mitigation of Impacts Spear Street/Swift Street intersection This intersection performed better than previous studies have indicated using current traffic counts and distributions. Under the future (2008 and 2013) AM design hour this intersection will experience an overall LOS C without the proposed Project and an LOS D with the Project. In addition, the northbound Spear Street shared left -through left turn movements experience LOS F during the AM design hour period under future 2008 and 2013 conditions. The westbound Swift Street approach through movement is also predicted to operate at an LOS Page 24 South Village Traffic Impact Study April, 2004 E under future 2013 Am conditions. As has previously been suggested, the current the northbound approach of Spear Street has a shared left -through lane and an exclusive right turn lane at the Swift Street intersection. The suggested mitigation involves the reconfiguration of the Spear Street northbound approach to provide an exclusive left turn and a shared through/right lane at the intersection. Spear Street/Allen Road Intersection This intersection will degrade to a LOS of E during the 2008 AM design hour and LOS F during the 2013 AM design hour without the proposed Project. With the proposed signalization of this intersection, the LOS improves to LOS B for all future conditions. Installation of this signal should also aid other access driveways along Spear, especially those north of Allen Road. Spear Street/Barstow Road This intersection will degrade to an overall LOS of F in the PM period in 2008, and an LOS of F for both AM and PM periods in 2013 without the Project. Highway Capacity Manual analysis shows this intersection continuing to perform at these same levels, for the same time periods, with the 2008 AM design hour performance degrading to an LOS E (2008 AM LOS is D without the Project). However, the installation of the proposed signal at Allen Road and the central Project entrance shows in microsimulation that the Barstow/Spear intersection appears to perform better than HCM methodologies predict. No changes are proposed for this intersection. Barstow Road/Dorset Street/Cheese Factory Road This intersection performs at an LOS of C or better under all future scenarios, with and without the proposed Project. No changes are proposed for this intersection. Page 25 South Village Traffic Impact Study April, 2004 Allen Road/Shelburne Road This intersection is currently being reconstructed to create two northbound and two southbound lanes, with a central median and bicycle lanes in both directions. This intersection performs at an LOS of A under all future scenarios, with and without the proposed Project. No changes are proposed for this intersection. Page 26 South Village Traffic Impact Study April, 2004 Technical Appendix Page 27 South Village Vehicular Trip Generation ITE Trip Generation 7th Edition Description Dwellings/Q Weekday Weekday., uantity AM pk Enter Exit PM Peak Enter Exit LUC LUC North @ Spear Single Family 32 363 32 8 24 38 24 14 210 LUC Multi Family 17 142 13 2 11 14 9 5 230 505 45 10 35 52 33 19 less 5% East 25 2 1 2 3 2 1 net 480 43 9 33 49 31 18 total: 49 LUC Central entrance Single Family 98 1,018 78 20 58 105 66 39 210 LUC Multi Family 21 170 15 3 12 17 11 6 230 LUC luxury flats 34 25 6 19 1 1 0 233 LUC middle school 50 81 27 15 12 15 7 8 522 LUC High school 50 153 41 28 13 48 15 33 530 LUC Apartments 77 782 44 9 35 54 35 19 221 total: 230 2,204 230 81 149 240 135 105 less 5% East 110 11 4 7 12 7 5 net 2,094 219 77 142 228 128 100 LUC South @ Spear Single Family 26 300 28 7 21 32 20 12 210 LUC Multi Family 27 211 18 3 15 21 14 7 230 total: 53 511 46 10 36 53 34 19 less 5% East 26 2 1 2 3 2 1 net 485 44 9 34 50 32 18 332 TND Engineering P O Box 388 Ossipee, NH 03864 Turning Movement Count Report 1/15/04 Start Time: 4:00 PM SOUTHBOUND WESTBOUND TND Engineering 1270 Rte 16, Box 388 Ossipee, NH 03864 NORTHBOUND EASTBOUND Street Name Spear Swift Spear Swift INTSEC HOUR Start Time Left I Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTAL 4:00 PM 10 38 19 25 26 14 24 32 25 11 27 43 294 4:15 PM 13 50 15 30 28 6 39 26 37 10 37 47 338 4:30 PM 10 57 22 27 33 6 28 34 23 8 38 54 340 4:45 PM 15 84 18 39 21 3 36 26 20 7 37 67 373 1345 5:00 PM 19 66 27 38 17 8 53 43 21 7 36 56 391 1442 5:15 PM 20 95 34 28 30 14 38 33 31 5 41 101 470 1574 5:30 PM 15 81 14 26 31 7 41 29 29 12 60 108 453 1687 5:45 PM 28 77 25 35 22 11 46 36 26 8 41 78 433 1747 3092 Approach Total 852 525 776 939 3092 Grand Total 130 548 174 248 208 69 305 259 212 68 317 554 Approach % 15.3% 64.3% 20.4% 47.2% 39.6% 13.1% 39.3% 33.4% 27.3% 7.2% 33.8% 59.0% Total % 4.2% 17.7% 5.6% 8.0% 6.7% 2.2% 9.9% 8.4% 6.9% 2.2% 10.3% 17.9% Begin Peak Hour: 5:00:00 PM Peak Interval: 5:16 Peak Hour Vol: 82 319 100 127 100 40 178 141 107 32 178 343 1747 Percent: 4.7% 18.3% 5.7% 7.3% 5.7% 2.3% 10.2% 8.1 % 6.1 % 1.8% 10.2% 19.6% Peak Intvl Vol: 20 95 34 28 30 14 38 33 31 5 41 101 470 ,High Intvl Vol: 1 28 95 34 1 38 31 14 1 53 43 31 1 12 60 108 Peak Hour Factor: 0.93 Turning Movement Count Report 1/15/04 Start Time: 07:00 AM TND Engineering 1270 Rte 16, Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Spear Swift Spear Swift INTSEC HOUR Start Time Left I Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTAL 7:00 AM 1 12 2 14 14 16 36 53 25 5 6 6 190 7:15 AM 3 22 2 15 46 28 48 61 28 7 10 19 289 7:30 AM 2 22 8 10 60 35 54 59 27 8 12 9 306 7:45 AM 4 41 7 36 125 39 74 89 23 10 20 27 495 1280 8:00 AM 5 24 14 21 96 38 58 83 17 19 13 18 406 1496 8:15 AM 8 40 8 24 77 40 76 70 20 10 14 29 416 1623 8:30 AM 2 35 10 32 60 11 66 61 13 10 14 24 338 1655 8:45 AM 6 14 10 23 54 18 52 61 22 7 19 24 310 1470 2750 Approach Total 302 932 1176 340 2750 Grand Total 31 210 61 175 532 225 464 537 175 76 108 156 Approach % 10.3% 69.5% 20.2% 18.8% 57.1 % 24.1 % 39.5% 45.7% 14.9% 22.4% 31.8% 45.9% Total % 1.1% 7.6% 2.2% 6.4% 19.3% 8.2% 16.9% 19.5% 6.4% 2.8% 3.9% 5.7% Begin Peak Hour: 7:45 Peak Interval: 7:45 Peak Hour Vol: 19 140 39 113 358 128 274 303 73 49 61 98 1655 Percent: 1.1 % 8.5% 2.4% 6.8% 21.6% 7.7% 16.6% 18.3% 4.4% 3.0% 3.7% 5.9% Peak Intvl Vol: 4 41 7 36 125 39 74 89 23 10 20 27 495 High Intvl Vol: 8 41 14 1 36 125 40 76 89 23 1 19 20 29 i Peak dour Factor: U.M Turning Movement Count Report 1/15/04 Start Time: 07:00 AM TND Engineering 1270 Rte 16 , Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Spear Spear Allen INTSEC HOUR Start Time Left Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTAL 7:00 AM 17 11 16 56 26 14 140 7:15 AM 34 18 30 65 16 5 168 7:30 AM 37 20 38 129 26 11 261 7:45 AM 36 39 67 109 21 4 276 845 8:00 AM 30 35 37 101 20 13 236 941 8:15 AM 40 32 34 108 15 3 232 1005 8:30 AM 33 33 30 104 20 2 222 966 8:45 AM 32 24 27 58 31 4 176 866 1711 Approach Total 471 0 1009 231 1711 Grand Total 0 259 212 0 0 0 279 730 0 175 0 56 Approach % 0.0% 55.0% 45.0% 27.7% 72.3% 0.0% 75.8% 0.0% 24.2% Total % 0.0% 15.1 % 12.4% 0.0% 0.0% 0.0% 16.3% 42.7% 0.0% 10.2% 0.0% 3.3% Begin Peak Hour: 7:30 Peak Interval: 7:45 Peak Hour Vol: 0 143 126 0 0 0 176 447 0 82 0 31 1005 Percent: 0.0% 14.2% 12.5% 0.0% 0.0% 0.0% 17.5% 44.5% 0.0% 8.2% 0.0% 3.1 % Peak Intvl Vol: 0 36 39 0 0 0 67 109 0 21 0 4 276 High Intvl Vol: 1 0 40 39 1 0 0 0 1 67 129 0 1 26 0 13 IPeak Hour Factor: 0.91 Turning Movement Count Report 1115/04 Start Time: 4:00 PM SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Spear Spear Allen INTSEC HOUF Start Time Left I Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTA 4:00 PM 58 26 9 49 34 17 193 4:15 PM 70 30 11 41 19 13 184 4:30 PM 77 34 13 44 29 31 228 4:45 PM 110 49 18 34 30 26 267 872 5:00 PM 91 35 16 53 43 37 275 954 5:15 PM 109 36 19 56 30 31 281 1051 5:30 PM 92 42 19 38 28 28 247 1070 5:45 PM 62 29 14 32 22 18 177 980 1852 Approach Total 950 0 466 436 1852 Grand Total 0 669 281 0 0 0 119 347 0 235 0 201 Approach % 0.0% 70.4% 29.6% 25.5% 74.5% 0.0% 53.9% 0.0% 46.1% Total % 0.0% 36.1 % 15.2% 0.0% 0.0% 0.0% 6.4% 18.7% 0.0% 12.7% 0.0% 10.9% Begin Peak Hour: 4:45:00 PM Peak Interval: 17:15 Peak Hour Vol: 0 402 162 0 0 0 72 181 0 131 0 122 1070 Percent: 0.0% 37.6% 15.1% 0.0% 0.0% 0.0% 6.7% 16.9% 0.0% 12.2% 0.0% 11.4% Peak Intvl Vol: 0 109 36 0 0 0 19 56 0 30 0 31 281 Hiah Intvl Vol: 0 109 42 0 0 0 19 56 0 43 0 37 TND Engineering 1270 Rte 16, Box 388 Ossipee, NH 03864 Turning Movement Count Report 1/15/04 Start Time: 07:00 AM TND Engineering 1270 Rte 16 , Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Spear Barstow Spear Swift INTSEC HOUR Start Time Left I Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTAL 7:00 AM 9 14 11 15 44 18 111 7:15 AM 6 33 8 31 69 15 162 7:30 AM 9 37 15 33 112 24 230 7:45 AM 8 48 20 48 121 27 272 775 8:00 AM 18 30 22 29 111 25 235 899 8:15 AM 12 35 8 40 104 18 217 954 8:30 AM 8 37 15 24 113 16 213 937 8:45 AM 3 33 9 19 54 20 138 803 1578 Approach Total 340 347 891 0 1578 Grand Total 73 267 0 108 0 239 0 728 163 0 0 0 Approach % 21.5% 78.5% 0.0% 31.1 % 0.0% 68.9% 0.0% 81.7% 18.3% #DIV10! #DIV/0! #DIV/01 Total % 4.6% 16.9% 0.0% 6.8% 0.0% 15.1 % 0.0% 46.1 % 10.3% 0.0% 0.0% 0.0% Begin Peak Hour: 7:30 Peak Interval: 7:45 Peak Hour Vol: 47 150 0 65 0 150 0 448 94 0 0 0 964 Percent: 4.9% 15.7% 0.0% 6.8% 0.0% 15.7% 0.0% 47.0% 9.9% 0.0% 0.0% 0.0% Peak Intvl Vol: 8 48 0 20 0 48 0 121 27 0 0 0 272 High Intvl Vol: 18 48 0 22 0 48 1 0 121 27 0 0 0 Peak Hour Factor: U.88 I Turning Movement Count Report 1 /15/04 Start Time: 4:00 PM TND Engineering 1270 Rte 16, Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Spear Barstow Spear Swift INTSEC HOUR Start Time Left I Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTAL 4:00 PM 22 52 19 13 45 16 167 4:15 PM 13 72 20 10 35 18 168 4:30 PM 33 69 21 13 39 18 193 4:45 PM 29 85 25 17 26 18 200 728 5:00 PM 37 83 18 17 58 18 231 792 5:15 PM 40 112 19 11 60 20 262 886 5:30 PM 31 98 27 15 40 19 230 923 5:45 PM 19 79 28 10 33 12 181 904 1632 Approach Total 874 283 475 0 1632 Grand Total 224 650 0 177 0 106 0 336 139 0 0 0 Approach % 25.6% 74.4% 0.0% 62.5% 0.0% 37.5% 0.0% 70.7% 29.3% #DIV/0! #DIV/0! #DIV/0! Total % 13.7% 39.8% 0.0% 10.8% 0.0% 6.5% 0.0% 20.6% 8.5% 0.0% 0.0% 0.0% Begin Peak Hour: 4:45:00 PM Peak Interval: 5:15 Peak Hour Vol: 137 378 0 89 0 60 0 184 75 0 0 0 923 Percent: 14.8% 41.0% 0.0% 9.6% 0.0% 6.5% 0.0% 19.9% 8.1 % 0.0% 0.0% 0.0% Peak Intvl Vol: 40 112 0 19 0 11 0 60 20 0 0 0 262 High Intvl Vol: 1 40 112 0 1 27 0 17 1 0 60 20 1 0 0 0 Peak Hour Factor: 0.88 Turning Movement Count Report 1 /15/04 Start Time: 07:00 AM TND Engineering 1270 Rte 16, Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Dorset Cheese Factory Dorset Barstow INTSEC HOUR Start Time Left I Thru Right Left I Thru Right Left I Thru Right Left I Thru Right TOTAL TOTAL 7:00 AM 6 9 5 2 15 8 7 17 8 8 17 1 103 7:15 AM 2 7 1 9 24 4 9 34 12 8 14 4 128 7:30 AM 6 8 1 5 31 24 8 68 19 4 16 0 190 7:45 AM 6 13 4 5 42 14 17 57 26 12 29 3 228 649 8:00 AM 13 10 2 4 28 10 9 43 19 10 30 5 183 729 8:15 AM 8 13 5 14 27 11 3 40 19 4 23 1 168 769 8:30 AM 4 11 8 5 24 11 11 33 11 10 17 2 147 726 8:45 AM 6 14 6 4 15 10 6 39 20 10 19 1 150 648 1297 Approach Total 168 346 535 248 1297 Grand Total 51 85 32 48 206 92 70 331 134 66 165 17 Approach % 30.4% 50.6% 19.0% 13.9% 59.5% 26.6% 13.1 % 61.9% 25.0% 26.6% 66.5% 6.9% Total % 3.9% 6.6% 2.5% 3.7% 15.9% 7.1 % 5.4% 25.5% 10.3% 5.1 % 12.7% 1.3% Begin Peak Hour: 7:30 Peak Interval: 7:45 Peak Hour Vol: 33 44 12 28 128 59 37 208 83 30 98 9 769 Percent: 4.3% 5.7% 1.6% 3.6% 16.6% 7.7% 4.8% 27.0% 10.8% 3.9% 12.7% 1.2% Peak Intvl Vol: 6 13 4 5 42 14 17 57 26 12 29 3 228 High Intvl Vol: 1 13 13 5 14 42 24 17 68 26 1 12 30 5 Peak Hour Factor: 0.84 Turning Movement Count Report 1/15/04 Start Time: 4:00 PM TND Engineering 1270 Rte 16 , Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Dorset Cheese Factory Dorset Barstow INTSEC HOUR Start Time Left I Thru Right Left I Thru Right Left I Thru Right Left I Thru Right TOTAL TOTAL 4:00 PM 10 17 5 12 27 7 4 16 11 5 22 10 146 4:15 PM 6 43 5 12 17 6 0 10 9 7 19 3 137 4:30 PM 8 41 13 15 27 4 2 15 7 7 24 7 170 4:45 PM 9 40 6 20 30 11 3 11 9 8 29 14 190 643 5:00 PM 6 47 5 19 26 9 4 21 7 10 26 8 188 685 5:15 PM 9 43 6 30 32 3 2 11 4 7 36 17 200 748 5:30 PM 9 50 12 25 31 6 0 10 12 14 19 14 202 780 5:45 PM 10 26 8 16 26 12 3 12 13 7 16 15 164 754 1397 Approach Total 434 423 196 344 1397 Grand Total 67 307 60 149 216 58 18 106 72 65 191 88 Approach % 15.4% 70.7% 13.8% 35.2% 51.1 % 13.7% 9.2% 54.1 % 36.7% 18.9% 55.5% 25.6% Total % 4.8% 22.0% 4.3% 10.7% 15.5% 4.2% 1.3% 7.6% 5.2% 4.7% 13.7% 6.3% Begin Peak Hour: 4:45 Peak Interval: 5:30 Peak Hour Vol: 33 180 29 94 119 29 9 53 32 39 110 53 780 Percent: 4.2% 23.1 % 3.7% 12.1 % 15.3% 3.7% 1.2% 6.8% 4.1 % 5.0% 14.1 % 6.8% Peak Intvl Vol: 9 50 12 25 31 6 0 10 12 14 19 14 202 Peak Hour Factor: 0.97 Turning Movement Count Report 1 /15/04 Start Time: 07:00 AM TND Engineering 1270 Rte 16 , Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Route 7 Allen Route 7 INTSEC HOUR Start Time Left I Thru Right Left Thru Right Left Thru Right Left Thru Right TOTAL TOTAL 7:00 AM 2 133 18 17 171 25 366 7:15 AM 9 130 22 33 213 18 425 7:30 AM 11 143 33 35 248 40 510 7:45 AM 22 139 41 60 257 24 543 1844 8:00 AM 15 122 38 52 205 35 467 1945 8:15 AM 29 144 30 50 260 25 538 2058 8:30 AM 15 153 32 33 223 19 475 2023 8:45 AM 9 166 41 42 210 28 496 1976 3820 Approach Total 1242 577 2001 3820 Grand Total 112 1130 0 255 0 322 0 1787 214 Approach % 9.0% 91.0% 0.0% 44.2% 0.0% 55.8% 0.0% 89.3% 10.7% Total % 2.9% 29.6% 0.0% 6.7% 0.0% 8.4% 0.0% 46.8% 5.6% Begin Peak Hour: 7:30 Peak Interval: 7:45 Peak Hour Vol: 77 648 0 142 0 197 0 970 124 2058 Percent: 3.7% 26.6% 0.0% 6.9% 0.0% 9.6% 0.0% 47.1% 6.0% Intvl Vol: 22 139 0 41 0 60 0 257 24 543 Peak Hour Factor: 0.95 i Turning Movement Count Report 1 /15/04 Start Time: 04:00 PM TND Engineering 1270 Rte 16, Box 388 Ossipee, NH 03864 SOUTHBOUND WESTBOUND NORTHBOUND EASTBOUND Street Name Route 7 Allen Route 7 INTSEC HOUR Start Time Left I Thru Right Left Thru Right Left I Thru Right Left Thru Right TOTAL TOTAL 4:00 PM 12 171 28 21 154 17 403 4:15 PM 26 198 35 18 105 8 390 4:30 PM 29 260 27 21 173 22 532 4:45 PM 29 254 53 15 125 17 493 1818 5:00 PM 33 210 38 14 172 24 491 1906 5:15 PM 26 276 48 24 129 22 525 2041 5:30 PM 18 245 47 10 169 24 513 2022 5:45 PM 13 193 30 18 89 14 357 1886 3704 Approach Total 1993 447 1264 3704 Grand Total 186 1807 0 306 0 141 0 1116 148 Approach % 9.3% 90.7% 0.0% 68.5% 0.0% 31.5% 0.0% 88.3% 11.7% Total % 5.0% 48.8% 0.0% 8.3% 0.0% 3.8% 0.0% 30.1 % 4.0% Begin Peak Hour: 4:30:00 PM Peak Interval: 4:30:00 PM Peak Hour Vol: 117 1000 0 166 0 74 0 599 86 2041 Percent: 5.7% 49.0% 0.0% 8.1% 0.0% 3.6% 0.0% 29.3% 4.2% Intvl Vol: 29 260 0 27 0 21 0 173 22 532 Peak Hour Factor: 0.96 Existing 2004 Conditions Without Project Existing AMDHV Design Volumes M V- co co South Village namRignnd txisiting Conditions AMDHV C:\My Documents\soburlington\traffic study0004 AMDHV.sy7 Volumes Existing AMDHV South Village Design Volumes ndinRl?nnd txisiting Uonditions AMDHV CAMy Documents\soburlington\traffic study\2004 AMDHV.sy7 Volumes Existing AMDHV South Village Design Volumes 04/08/2004 70 L r CO rn —223 � g0 den Rd CO o o� a IY a� c 92--7 :e 35� � rn -a � rn o r U) U) I- CU Q) ``^Q^ vJ txisiting Gonclltions AMDHV CAMy Documentslsoburlingtonitraffic study12004 AMDHV.sy7 Volumes Existing AMDHV Design Volumes 34� W L Q LO rn I � N South Village narnR12nna Fa txisiting Conditions AMDHV CAMy Documents\soburlington\traffic study\2004 AMDHV.sy7 Volumes Exisitng Conditions AMDHV South Village 1: Swift St & Spear St 04/08/2004 Mb T WBR ' NBL , NBT' `NBR 'SBL SBT' SBR Lane Configurations t t r t t Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lost time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0, Lane Util. Factor 1_00 1.00 1.00 1.00 1.00 1-00 1.00 1.00 Frt 1.00 0.85 1.00 0.85 1.00 0.97 1.00 0,97", Flt Protected 0.98 1.00 099 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1701 1478 1718 1583 1770 1688 1711 2043 FIt Permitted 0.55 1.00 0.88 1.00 0.57 1-00 0.28 1.00 Satd. Flow (perm) 957 1478 1532 1583 1053 1688 507 2043 Volume (vph) 55 6-9 ill 128 405 145 310 342 82 21 158 44 Peak -hour factor, PHIF 0.84 0.84 0.84 0.84 0,84 0.84 0.84 0,84 0,84 0.84 0.84 0.84 Adj. Flow (vph) 65 82 132 152 482 173 369 407 98 25 188 52 RTOR Reduction (vph) 0 0 70 0 0 75 0 11 0 0 13 0 Lane Group Flow (vph) 0 147 62 0 634 98 369 494 0 25 227 0. Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Actuated Green, G (s) 30-8 30.8 30.8 30.8 27.1 27.1 27.1 271 Effective Green, g (s) 30.8 30.8 30.8 30.8 27.1 27.1 27.1 27A Actuated g/C Ratio 0.47 0.47 0.47 0.47 0.41 0.41 0.41 0.41 Clearance Time (s) 4,0 4.0 4.0 4.0 4.0 4.0 4,0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3,0 3.0 3.0 3.0 Lane Grp Cap (vph) 447 691 716 740 433 694 208 840 v/s Ratio Prot 0-30 0.12 v/s'Ratio Perm 0.15 0.09 c0.411 0.11 c0,35 0.05 v/c Ratio 0-33 0.09 0.89 0.13 0.85 0.71 0.12 0.27 Uniform Delay, dl 11'0 9,8 15.9 10.0 17.6 16.1 12.0 112.9 Progression Factor 1.00 1.00 1-00 1.00 1.00 1-00 1.00 1.00 W*$lWntal Delay, d2 0.4 0.1 12.6 0.1 14.9 3.5 0.3 0.2 Delay (s) 11.5 9.8 28.6 10.0 32.5 19.6 12.3 13.0 Lev B A C B C B B B Approach Delay (s) 10.7 24.6 25.0 13.0 Approach LOS B C, B HCM Volume to Capacity ratio Actuated Cycle Length (s) Intersection Capacity Utilization AnalyTiis Period (min) c Critical Lane Group 0.87 65.9 Sum of lost time (s) 8.0 76.6% ICU Level of Service D 15 Exisiting Conditions 01/15/2004AMDHV Retrovest TND Engineering C.-\My Documents\soburlington\traffic study\2004 AMDHV.sy7 Exisitng Conditions AMDHV South Village 2: Allen Rd & Spear St 04/08/2004 t t OEM EBR ME Lane Configurations t t Sign Control Stop Free Fr Grade 0% 0% 0% vYe?� A, ...,t,._.:: 92 35 199 505 162 142 Peak Hour Factor 0.91 0.91 0.91 0.91 0.91 0.91 **W*ate ( R01 38 ..._ 219 555 178 156 � Pedestrians` ..,,A,... ,. Lane Width (ft) z: 01 Walking Speed (ft/s) x Percent Blockage g Right turn flare (veh) Median type None Median storage veh) Upstream signal (ft) pX, platoon unblocked vC, conflicting volume 1170 178 334 vC 1, stage 1 conf vol vC2, stage 2 conf vol A vCu, unblocked vol 1170 178 334 �(c (s), 6 A 6.2 4.1Wil iiiiiiiimiiiiiiiiiimft,{x tC, 2 stage (s) ..,_, . ohm "imp, p0 queue free % 42 96 82 �r �y cM capacity, (veh/h) " 175 s; %,.: _. ,. .'., 't21J ' -, 5� 178 Volume Left 101 0 219 0 0 0 Volume Right 0 38 0 0 0 156u� ` cSH 175 865 1225 1700 1700 .��, �..'� 1700 %w e"(o Capacity 0.58 0.04 0.18 0.33 0.10 0.0 0 21... II, Queue Length (ft) 77 3 16 0 0 I ,V, gyp:. Control Delay (s) 50.4 9.4 8.6 0.0 0.0 0.0 M ' I Lane LOS F A A proacFi Delay (s) 39.1 2.4 ' 0.0 ��` �� Approach LOS E Exisiting Conditions 01/15/2004 AMDHV Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 AMDHV.sy7 Exisitng Conditions AMDHV South Village 3: Barstow Rd & Spear St 04/08/2004 a .,4N3 .... :, Lane Configurations Y vCu, unblocked vol 949 635 695 ,,, , : .,�� `;z �., . � � _ �^aF . '' , � • yaw �,�� f j , . � '�� °�� tC, 2 stage (s) ueue free % 69 60 93 {cjSH 388 1700 900 Queue Lenqth (ft) 134 0 5 Lane LOS D A Approach LOS D Average Delay 8.3 Period (min) 15 Exisiting Conditions 01/15/2004 AMDHV Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 AMDHV.sy7 Exisitng Conditions AMDHV South Village 4: Barstow Rd & Dorset St 04/08/2004 Lane Configurations„, Pion Corgfr"ol Stop Stop Stop Stop' Volume (vph) 34 111 10 32 145 67 42 235 94 37 50 14 u„ ...: U 8 ., 0 84 4 ,8' 0:84 t3 $4 (1` 84 `:Q 84 ti $4 : , .0.$4 0.84 0.84' . 0.84 Hourly flow rate (vph) 40 132 12 38 173 80 50 280 112 44 60 17 Volume Total (vph) 185 290 442 120 TN,4 F Volume Right (vph) 12 80 112 17 Departure Headway (s) 6.2 5.8 5.5 6.2N �. Y�:T �15 (veh/h) 9 627 495 {Capaciity �.J'��y.;a r r � :: �� .. � ..�� , n s 5" M�. IM Approach Delay (s) 12.0 13.8 18.9 10.8 LevelHCM of Service C in,erse�on CWA",Ut(ftrora 44 O to ICU LevelW. o gar, ., m,. .,.. _. ..', Analysis Period (min) 15 Exisiting Conditions 01/15/2004 AMDHV Retrovest TND Engineering CAMy Documents\soburlington\traffic study\2004 AMDHV.sy7 Exisitng Conditions AMDHV South Village 5: Allen Rd & Shelburne Rd 04/08/2004 "r, t �► 1 Lane Configurations ►j r t r Ideal Flow (vphpl,) 1900" 1900 1900 1900 1900 1900 Lane Width 12 12 12 12 10 14 Total Lost time (s) 4.0 4.0 4.0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.85 1.00 0.85 1.00 1 `.00 ' ` Fit Protected 0.95 1.00 1.00 1.00 0.95 1.00 Satd. Flow (prat) 1770 1583 1863 1583 1652 1 987' ` �3 y ill Fit Permitted 0.95 1.00 1.00 1.00 0.09 5_ a 1.00 Satd. Flow (perm) 1770+ 1583 1863 1583 155 1987 Volume (vph) 160 223 1096 140 87 619 Peak -hour factor, PHF 0.95 0.95 0.95 0.95 0.95 0`.95 Adj. Flow (vph) 168 235 1154 147 92 652 RTOR Reduction (vph) 0, 83 0 39 0 0 Lane Group Flow (vph) 168 152 1154 108 92 652 Turn Type Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 8 2 6 Ilk 4M Actuated Green, G (s) 11.4 11.4 44.8 44.8 44.8 44.8 Effective Green, g (s) 11 A 11.4 44.8 44.8 44.8 44,8 Actuated g/C Ratio 0.18 0.18 0.70 0.70 0.70 0.70 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 314 281 1300 1105 108 1387 v/s Ratio Prot 0.09 c0.62 0.33 v/s Ratio Perm 0,15 0,09 0.59 v/c Ratio 0.54 0.54 0.89 0.10 0.85 0.47 Uniform Delay, d1 24.0 24.0 7.7 3.1 7.2 4.4 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 1.8 2.1 7.7 0.0 43.9 0.3 Delay (s) 25.7 26.1 15A 3.2 51.1 4.6 Level of Service " C C B A D A Approach Delay (s) 26.0 14.0 10.4 Approach LOS , : C B B . J' � 4 R HCM Average Control i1+)ay "�� `1'4:9' HCtvt level 4f Service ... B ,;'a HCM Volume to Capacity ratio 0.88 Actuated Cycle Length (s) 64.244,Sum of lost time (s) 8.0 Intersection Capacity Utilization 81.4% ICU Level of Service D Analysis eriod (min) 15 IN c Critical Lane Group .Y€Rig Exisiting Conditions 01/15/2004 AMDHV Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 AMDHV.sy7 Existing PMDHV South Village No Build 04/08/2004 Exisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic study12004 PMDHV.sy7 Volumes Existing PMDHV South Village No Build nwnw2nnd co a� a a' a� L a� r oco cv cn s---g4 Rd +.w j 138� �o � L N co co L cu Q� co N ,101 txisiting Conditions PMdhv CAMy Documents\soburlington\traffic studyk2004 PMDHV.sy7 Volumes Existing PMDHV South Village I No Build 04/08/2004 148--"' 138- m CD N co co 0 CL ^� N � ,101 r� CO Barstow R W co Ca Exisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic studyA2004 PMDHV.sy7 Volumes Existing PMDHV South Village No Build 0410R190n4 M M Barstow """"'"mow., Rd G '--134 k'106CI7 eeso F..accttOrY 124 Rd- a� L 0 txisiting conditions PMdhv CAMy Documents\soburlington\traffic study\2004 PMDHV.sy7 Volumes Exisitng ConditionsPMDHV South Village 1: Swift St & Spear St 04/08/2004 1 41 EBT EBR 'WBL WBT WBR NBL NBT NBR ! . SBL ' SBT' SBIR Lane Configurations t r t if t t Ideal Flow (vphpi) 1900 1900 1900 1900 1900 1900 1900 ,1900. 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lost time (s) 4.0 4.0 4.0 4.0 4,0 4.0 4.0 4.0; 1 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1.00 0.85 1,00 0.85 1.00 0.94 1.00 0.96 Flt Protected 0.99 1.00 0.97 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1725 1478 1691 1583 1,770 1626 1711 2035 Flt Permitted 0.92 1.00 0.69 1.00 0.36 1.00 0.57 1.00 Satd. Flow (perm) 1599 1478,K, 1202 1583 666 `' 1626 1033 2035 Volume (vph) 36 201 388 144 113 45 201 159 121 93 360 113 P Y' ctor, PHF 0.93 Of 0.93 0.93 0.93 '' 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 Adj. Flow (vph) 39 216 417 155 122 48 216 171 130 100 387 122 RT-,,O, ction (vph) ` 0 » 0 206 0 0 32 0 64 '' 0 0 26 0 Lane Group Flow (vph) 0 255 211 0 277 16 216 237 0 100 483 0 Tue e custom custom 'Perm Perm Perm Perm Protected Phases 8 2 6 P .: SOS 4 4 4 8 8 2 6 Actuated Green, G (s) 12.3 12.3 12.3 12.3 16.1 16.1 16.1 16.1 12.3 12.3 12.3 12.3 16.1 16.1 16.1 16,11 Actuated g/C Ratio 0.34 0.34 0.34 0.34 0.44 0.44 0.44 0.44 3 Clef .�MM me .::.` {s} 4.0 �=,.;4.0 4.0 4.0 4.0 4.0 40 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 540 499 406 535 295 719 457 900 v/s Ratio Prot 0.19 0.25 v/s'Ratio Perm 0.16 0.28 0.23 0.03 c0.32 0.10 v/c Ratio 0.47 0.42 0.68 0.03 0.73 0.33 0.22 0.54 Uniform Delay, d1 9.5 9.3 10.4 8.1 8.4 &6 6.3 7.4 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.7 0.6 4.7 0.0 14.9 1.2 1.1 2.3 Delay (s) 10.1 9.9 15.1 8.1 23.2 7.9 7.4 9.7 fService A ...�� .� B A ;` C A Approach Delay (s) 10.0 14.0 14.3 9.3 HCM Volume to Capacity ratio 0.78 Actuated Cycle Length (s) 36.4 Sum of lost time (s) Intersection Capacity Utilization 76.8% ICU Level of Service rplysis Period (min) 16 c Critical Lane Group 8.0 D a E Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 PMDHV.sy7 Exisitng ConditionsPMDHV South Village 2: Allen Rd & Spear St 04/08/2004 b _e„rri"""..e W � ."... s I B `1=BR NBL NBT SBT , Lane Configurations t t r Sign Control Stop Free Free:iV Grade 0% 0% 0% Volume (veh/h) 148 138 81 205 454 183 Peak Hour Factor 0.95 0.95 0.95 0.95 0.95 0.95 Hourly flow rate,(vph) 156 145 85 216 478 193 Pedestrians K„ Lane Width {ft}` Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None'" Median storage veh) , " Upstream signal (ft) pX, platoon unblocked ,... vC, conflicting volume 864 478 671 r vC 1, stage 1 conf vol vC2, stage 2 conf vol vCu, unblocked vol 864 478 671 tC,' Ingle (s) 6.4, 4.1 tC, 2 stage (s) ..6.2 : tF �s) 3.5 3:3 2.2 p0 queue free `% 47 75 91 cM capacity (veh/h) 294 587 920 ©ir ctlokLan6 # ,. NB' 1 NB 2 SB Volume Total 156 145 85 216 Volume Left 156 0 85 0 0 n Volume Right 0 145 0 0 0 193 Ism," cSH 294 587 920 1700 1700 1700 Capacity 0.53 0.25 0.09 ` 0.13 0.28 0,11 Queue Length (ft) 72 24 8 0 0 0 Cor trol Delay (s) H 30.2 13.1 .9.3 0.0 0.0 0.0 ' Lane LOS D B A 00 Delay (s) 21.9 2.6 0.0 Approach LOS C Average Delay 5.8 lnterse6t0i Capacity Utilization 46.6% ICU Level of Service Analysis Period (min) 15 , Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 PMDHV.sy7 Exisitng ConditionsPMDHV South Village 3: Barstow Rd & Spear St 04/08/2004 t l4 rent :, �1 kL ,WBR NBT Lane Configurations Sign Control Stop Free Free Grade 0`% 0%° 0% Volume (veh/h) 101' 68 208 85 155 427 Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 0.88 Hourly flow rate (vph) 1,15 77 236 97 176 485 . ,"_ .��_. ..: Pedestrians Larie'Widtlt (ft) H �,�,...,.t:��.g. . a Walking Speed (ft/s) , .'MAIM", .",. Percent Blockage n .n Right turn flare (veh) Median type `a None Median storage veh) Upstream --signal +(ft) Owl pX, platoon unblocked vC conflicting volume 1122 285;; vC1, stage 1 conf vol vC2 e 2 conf vol ,a M ., vCu, unblocked vol 1122 285 333 #C,single,(s)... u�.v, 6.4 6.2 4.1 F: r,. , . tC, 2 stage (s) . ,. 3.5 3.3 2 2 , p0 queue free % 41 90 86 195.; 1226 .�(vehlh), .754, Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering CAMy Documents\soburlington\traffic study\2004 PMDHV.sy7 Exisitng ConditionsPMDHV South Village 4: Barstow Rd & Dorset St 04/08/2004 � � --;� ~ � 4\ l i Nfd ern` :, ,x .._ _...,. 1*BT EBf2 WBL Wl3 ' WBR .. ='NBL NBT %.NBR `SBL` =Y. SBTs' `"SBR Lane Configurations +T+ +► + +T+ Sign Control Stop Stop Stop Stop Volume (vph) 44 124 60 106 134 33 10 60 36 37 203 33 Peak Hour Factor 0.97 0.97 0.97 0.97 0.97 0.97 0.97 0.97 0.97 0.97 0.97 0:97 Hourly flow rate (vph) 45 128 62 109 138 34 10 62 37 38 209 34 i> 't�orf. a'H EB 1 W6`1 NB 1 .�SI 1- , Volume Total (vph) 235 281 109 281 Volume'Left (vph) 45 109 10 3$M4' Volume Right (vph) 62 34 37 34 u Hadj (s) ; -0.09 0.04 -0.15 -0.01OW Departure Headway (s) 5A 5.5 5.7 5.5 Degree Utilization, x 0.35 0.43 0.17 0.43"' Capacity (veh/h) 611 615 543 604 f Control Delay (s) 11.4 12.5 9.9 12.6 Approach Delay (s) 11.4 12.5 9.9 12.6 i?? A B gg, ..o,... . .., .n„ w. '.. HCM Level of Service B tntersaCtif ri tad . (,...._. Analysis Period (min) 15 Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 PMDHV.sy7 Exisitng ConditionsPMDHV South Village 5: Allen Rd & Shelburne Rd 04/08/2004 i" I,- T I' �► NBR SBL SBT Lane Configurations r t �' >� t Ideal Flow (vphpl) . 1900 1900 1900 1900 1900 1900 �.. Lane Width 12 12 12 12 10 14 y.. ,..' . Total Lost time (s) 4.0 4.0 4.0 4.0 4.0 4.0 VIEW, Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 F i 1.00 0,85 1.00 -0.85 1 00 1.00 U�,.: Fit Protected 0.95 1.00 1.00 1.00 0.95 1.00 __ Satd. Flow (prot) 1770"` `1583 1863 1583 1652 1987 Fit Permitted 0.95 1.00 1.00 1.00 0.32 1.00 Satd. Flow (perm) 1770 1583 1863 1583 558 1987 Volume (vph) 188 84 677 96 132 1130 Peak -hour factor, PHF 0.96 0.96 0,96 0.96 0.96 0.96 Adj. Flow (vph) 196 88 705 100 138 1177 RTOR Reduction (vph) 0 72 0 30 0 '; 0 Lane Group Flow (vph) 196 16 705 70 138 1177 Turn Type Perm Perm Perm Protected Phases 8 2 6 Permitted ;Phases 8 2 6 Actuated Green, G (s) 12.2 12.2 47.1 47.1 47.1 47.1 Effective Green, g (s) 12.2 12.2 47.1 47.1' 47.1 47.1 Actuated g/C Ratio 0.18 0.18 0.70 0.70 0.70 0.70 Clearance Time, (s) 4.0 ° 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 10 Lane Grp Cap (vph) 321 287 1304 1108 391 1391 v/s Ratio Prot c0.11 0.38 c0.59 v/s Ratio Perm 0.06 0.06 0,25 v/c Ratio 0.61 0.06 0.54 0.06 0.35 0.85 Un o O Pelay, d1 25A 22.8 4.9 3.2 4.0 7.4 . Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 lric „ %ta1 Delay, d2 , 3A 0.1 0.5 0.0 0.6 4.9 a Delay (s) 28.8 22.9 5.3 3.2 4.6 12.4 Approach Delay (s) 26.9 5.1 11.6 Approach LOS C A : B., HCM Volume to Capacity ratio 0.80 Actuated Cycle Length (s) 673 Sum of lost time (s) 8,0 Intersection Capacity Utilization 76.6% ICU Level of Service D period (min) 15 c Critical Lane Group Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2004 PMDHV.sy7 Future 2008 Conditions Without Project Future AMPKHR South Village 2008 No Build 04/08/2004 Future Conditions AMDHV 2008 CAMy Documents\soburlington\traffic study\2008 AMDHV.sy7 Volumes Future AMPKHR South Village 2008 No Build 04/08/2004 m a) 0' aD c .a (D L U) o c--232 �� g6 CO CO 'vier' Rd c 96— 7 L � 6 � N LO S 65 L cu N co Future Conditions AMDHV 2008 CAMy Documents\soburlingtonitraffic study12008 AMDHV.sy7 Volumes Future AMPKHR South Village 2008 No Build 04/08/2004 L cu Q U) LO `- "' '--177 �--76 o � i M N Q Future Conditions AMDHV 2008 CAMy Documentslsoburlingtonitraffic study12008 AMDHV.sy7 Volumes Future AMPKHR South Village 2008 No Build 04/08/2004 h �G l 51 3s� Cheese Fac 115� try Rd 1p d-q00 CD 4-j N U) N L Future Conditions AMDHV 2008 CAMy Documents\soburlington\traffic study\2008 AMDHV.sy7 Volumes Future Conditions AMDHV South Village 2008 No Build 04/08/2004 Mcavement ; =1=BL, .,;EBT: .EBR WBL WBT. WBR " NBL. ;;NBT NBR ''=SBL ° SBT". :'"5BR Lane Configurations t If t t t Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lostime (s) � � ti 4.0 4.0 4,0 4.0 4,0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt A 1.00 0,85 1.00 0,85 1.00 0.97 1.00 0.97 Flt Protected 0.98 1.00 0.99 1.00 0.95 1.00 0.95 1.00 Satd. Flow rat) "" "1701 1478 1718 1583 1770 1688 1711 2043 Flt Permitted 0.50 1.00 0.88 1.00 0.55 1.00 0.26 1.00 Satd. Flow (perm) `' 876 1478 1526 ` 1583 1025 ,'1688 473`'' 2043 Volume (vph) 55 69 111 128 405 145 310 342 82 21 158 44 Peak -hour factor, PHF 0.84 O.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 „0.84 0.84 Growth Factor (vph) 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% Adj. Flow (vph) 68 85 137 158 501 180 384 423 ;; 102 26 196 54 RTOR Reduction (vph) 0 0 73 0 0 74 0 11 0 0 13 0 Lane Group Flow (vph) ; 0 153 64 0 659 106 384 514 0 26 237 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Actuated Green, G (s) 33.1 33.1 " " 33.1 33.1 29.4 29.4 29.4 29.4 Effective Green, g (s) 33.1 33.1 33.1 33.1 29.4 29.4 29.4 29.4 Actuated 0/C Ratio 0,47 0.4,7 "� 0�47 0.42 0.42 �0,42 0.42 Clearance Time (s) 4.0 4.0 , 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 411 694 716 743 427 704 197 852 v/s Ratio Prot 0.31 0.12, , v/s Ratio Perm 0.17 0.09 c0.43 0.11 c0.37 0.05 u/c Ratio 0.37 0.09 0.92 0.14 0.90 0.73 0.13 0.28 ' Uniform Delay, d1 12.0 10.4 17.5 10.6 19.2 17.2 12.7 13.6 Progression Factor ,. 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 0.6 0.1 17.1 0.1 21.1 3.9 0.3 0.2 delay s":'op t�s., F 126 10,4 346 10.7 40.3 21.1 13.0 13.7 Level of Service B B C B D C B B Approach"Delay 11.6 29;5 29.2 13.7 I Approach LOS B ,. C » _., .... �. C B terS'@ctln Sure , HCM Average Control Delay 25.3 HCM Level of Service C HCM Volume to Capacity ratio 0.91` Actuated Cycle Length (s) 70.5 Sum of lost time (s) 8.0 n rs t o Capacity Utilizatio.,n of Service i �� I Analysis Period (min) 15 w �r � `ypl c Critical Lane Group Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV.sy7 Future Conditions AMDHV South Village 2008 No Build 04/08/2004 ---* --* T 1 ONAWNB Lane Configurations t t Sign Control Stop` Free Free'' '� �.,. WHOM Grade 0% 0% 0% , . ,IWA .. Volume (veh/h) 92 35 199 505 162 142 � Peak Hour Factor 0.91 0.91 0.91 0.91 0.91 0.91 Hourly flow rate (uph) 105' 4�27 577 $5 ... Pedestrians .162 . w°, ....: ,. ` Lane Width (ft),s:,t, Walking Speed (ft/s) Percent Blockage � Right turn flare (veh) Median type None; °; .;; �., ,. IN Median storage veh) Upstream signal (ft)��,��1k " � �y pX, platoon unblocked ,. "' vC, conflicting volume 1217 185, t� r �u. ''" NOW drr vC 1, stage 1 conf vol vC2, stage 2 conf von,... 01 vCu, unblocked vol 1217 185 347 tC, single (s) 6A tC, 2 stage (s) .,.., 3 .3 . . . P0 q queue free % 35 955 1 cM capacity (veh/h) 162 857 1211 ' Volume Total Volume Left Volume, Right cSH Volume§,"Capacity Queue Length (ft) Control lay (s) Lane LOS Approach LOS EB 1 EB 2 - NB,1 NR 2 105 40 227 577 185 162 105 0 227 0 0 0 0 40 0 0 0 162 162 857 1211 1700 1700 1700 0.65 0.05 0.19 0.34 0.11 0.10 ._ A: 91 4 17 0 0 0 60.9 9.4 8.7 0.0 0.0 0.0 ;;,�`� flIF�� . F A A w . �. e�� ,�. 46.7 2A 0..0 � -„�� - E erse ..tfaiMutilm_ a_NM Average Delay 6.7 Analysis IntersectiPerod (minon Capacity ) Utilization �f� 39.615 ° ICU Level of Services �� kI .. � .1 , �: Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV.sy7 Future Conditions AMDHV South Village 2008 No Budd 04/08/2004 j- Lane Configurations Grade 0% Volume (veh/h} 170 Peak Hour Factor 6.88 0.88 Hourly flow rate (vph) 86 201 Pedestrians vCu, unblocked vol 987 661 723 WIN tC, 2 stage (s) a .5 3.3 , p0 queue free % 66 57 93 r IAA '.--if- 1Zr AG7'.= Volume Total 287: 723 264, "a 11M,� Volume Left 86 0 63 N . eRight 201 125 0 cSH 372 1700 879 to Capacity 0.77 0.43 0.07mg Queue Length (ft) 159 0 6 Control Delay (s) 40.9 0.0 2.8 or, ... N Lane LOS E A,. �i rh Delay (s) 40.9' 0.0 2,8 Approach LOS E .. tlt . „ :y Average Delay 9.8 Intersection Capacity_ Utilization 71.8% ICU Level of Service C Analysis Period (min) 15 „i x Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV.sy7 Future Conditions AMDHV South Village 2008 No Build 04/08/2004 Lane Configurations +T+ +T+ +T+ Sign Co�""I Step Stop Stop Stop Volume (vph) 34 111 10 32 145 67 42 235 94 37 50 14 Peak Hour Factor 0.84 0.84 > 0.84 0.84 0,84 0.84 0.84 0.84 0.84 0.840.84 0.84 Hourly flow rate (vph) 42 137 12 40 180 83 52 291 116 46 62 17 Volume Total (vph) 192 302 459 125 Volume Left (vph) 42 40 52 46 Volume Right (vph) 12 83 116 17 Hadj (s) 004 -0.10' -0.10 0.02 rP Departure Headway (s) 6.3 6.0 5.6 6.4 Degree Utilization, x 0:34 O.50 0.72 0.22 Capacity (veh/h) 503 557 617 478 Control Delay (s) 12.5 14.8 21.5 11.2' Approach Delay (s) 12.5 14.8 21.5 11.2 Approach„LOS «. B M Level of Service C ICU Level of Service. A~_ .. I 9 . Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV.sy7 Future Conditions AMDHV South Village 2008 No Build 04/13/2004 1 Lane Width 12 12 12 12 10 14 4:0!...MK' `,t y f M Lane Util. Factor 1.00 1.00 0.95 1.00 0.95 Fit Protected 0.95 1.00 1.00 0.95 1.00 F (t lpro _ .�..._ Fit Permitted 0.95 1.00 1.00 0.16 1.00 ry Volume (vph) 160 223 1096 140 87 619 ,3MM El"r i , _ t _ Growth Factor (vph) 104% 104% 104% 104% 104% .. x,aG'n 104% yry RTOR Reduction (vph) 0 7a{{5��# 13 0 0 0 Turn Type Perm Perm Permitted Phases 8 6 Effective Green, g (s) 9.3 9.3 32.9 32.9 32.9 NOW gl� Ratio „a w Clearance Time (s) 4.0 4.0 4.0 4.0 y 4.0 YNrCiE: I�. xa Lane Grp Cap (vph) 328 293 2280 178 2474 ' M1 010119Z,-,^, "Iffik,.. 'x",« .ri v/s Ratio Perm 0.15 0.35 Uniform Delay, d1 18.5 18.7 4.8 4.6 3.6 qr 1.00 1 1 00 1.(i .` � ..> Incremental Delay, d2 1.7 2.7 0.4 3.1 , 0.1 « Del 20.2a Level of Service C C A A A £,�}� tW G j? %. Approach LOS C A u A HCM Average Control Delay 7.5 HCM Level of Service A , .. fig, . , r�,.z.. „ , ✓v, .v ,nvah.Yd ...Y...v ,. ... „n,,,; .., y °., " ,,,,, ,,,,,,,, P,f JJ ..,,,, ,�, 4 ? °^R V,_ ,.. „ i „': ,,,,,..._ 8.0 Actuated CycleLength(s) 50.2 Sum of lost time (s+)�y -N g �zi"Y, �iJti f l �✓' i�' ,. L% j er UEi'1.��k gv Q t, i ,F�w. .a' ,, », ..< va': %i43b3� Analysis Period (min) 15 ,._uz Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C-.\My Documents\soburlington\traffic study\2008 AMDHV.sy7 Future PMDHV No Build 2008 L Q) Q 00 �C� 8 So 40,4� l N N �^ South Village 04/08/2004 Exisiting Conditions PMdhv CAMy Doc umentslsoburlingtonitraffic study12008 PMDHV.sy7 Volumes Future PMDHV South Village No Build 2008 nd/nR/9nnd L -Q COLO Co V,--B7 96 �o 00 Q) 154-7 144--\ � oo r- N CO L M Q- CO txisiting Conditions PMdhv C:\My Documents\soburlington\traffic study\2008 PMDHV.sy7 Volumes Future PMDHV South Village No Build 2008 04/08/2004 Exisiting Conditions PMdhv CAMy Documentslsoburlington\traffic study12008 PMDHV.sy7 Volumes Future PMDHV No Build 2008 46-,,;�, 129, 62--\A Exisiting Conditions PMdhv "\-34 �139 10 Cheese eese South Village 04/08/2004 Factory R d CAMy Documents\soburlington\traffic study\2008 PMDHV.sy7 Volumes Future ConditionsPMDHV South Village 2008 No Build 04/13/2004 Movement EBL EBT EBR WBL WBT � WBR NBL , . NBT.£ 5BR Lane Configurations t t �r t t Ideal Flow (vphp{) 1900 1900 1900 1900 1900 1900 1900_ 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lost time (s) 4,0 4,0 4.0 4,0 4.0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt . 1,00 0.85 1 00 0.85 1.00 " 0.94 1,00 0.96 Fit Protected 0.99 1.00 0.97 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prot) 1726 1478 1691 1583 1770 1626 1711 2036 Fit Permitted 0.92 1.00 0.56 1.00 0.37 1.00 0.54 1.00 Satd. Flow (perm) 1599 1478 969 1583 680 1626& 965 2036 Volume (vph) 36 201 388 144 113 45 201 159 121 93 360 113 Peak -hour factor, PHF 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 ` 0.93 0.93 0.93 0.93 Growth Factor (vph) 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% Adj. `flow (vph) 40 225 434 161 126 50 225 178 135 104 " 403 126 RTOR Reduction (vph) 0 0 262 0 0 34 0 30 0 0 13 0 Lane Group Flow (vph) 0 265 172 0 287 16 225 283 0 104 516 0 Turn Type custom custom Perm Perm Perm Perm Protcted )phases 8 2 6 Permitted Phases 4 4 4 8 8 2 ,wv...��- �,.. 6 6,; '; .. d den, G (s) 22.3 22.3 22.3 22.3 , 39A 39.4 39.4 39A Effective Green, g (s) 22.3 22.3 22.3 22.3 39.4 39.4 39.4 39.4 Actuated g/C Ratio 0.32 0.32 0.32 0,32 0.57 0.57 0.57 0,57 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 512 473 310 506 384 919 545 1151 v/s Ratio Prot 0.19 0.26 v/s Ratio Perm 0.17 0.29 c0.30 0.03 c0.33 0.11 v/gjZatio 0.52 0.36 0.93 0.03 0.59 0.31 0.19 0.45 ( ; Uniform Delay, d1 19.3 18.2 22.9 16.3 9.8 8.0 7.4 8.8 Phiession Factor 1.00 1.00 1.00 _1.00 1.00 1.00 - 1.00 1.00 �. Incremental Delay, d2 0.9 0.5 32.2 0.0 6.4 0.9 0.8 1.3 Delay (s} 20,2 18.7 55.1 16.3 ' 16.3 8.8! `MF , `8.2 10.1 Level of Service C B E B B A A B Approach Delay (s) 19.3 49.3 11 9 �A Approach LOS B D B u A w, l"A HCM Average Control Delay 19.4 HCM Level of Service B HCM Volume to Capacity ratio 0.71 Actuated Cycle Length (s) 69.7 Sum of lost time (s) 8.0 Intersection Capacity Utilization , a'11 79.3%Q ICU Level of Services '; D Analysis Period (min) 15`` s (,IicalLane Group Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV.sy7 Future ConditionsPMDW South Village 2008 No Build 04/13/2004 NXertten . H �w...'BR NBL ' N8 Lane Configurations t t r SignControl Stop' FreeFree�$� tt€ Grade 0% 0% 0% Volume (veh/h) 148 138 81 205 454 183, Peak Hour Factor 0.95 0.95 0.95 0.95 0.95 0.95 F urly flow rate (vph) 162 151 89 224 497 200 qq Pedestrians t Vllidth (ft) a , � Walking Speed (ft/s) Percent Blockage F ' Right turn flare (veh) Median type None' .. �. Median storage veh) Ueam signal (ft) _R pX, platoon i inbInckeG1 VC, conflicting volume 899 497 697 vC1, stage 1 conf vol stage 2 conf volH�<z e E vCu, unblocked vol 899 497 697 tC, 2 stage (s) p0 queue free % 42 74 90 cM capacity (veh/h) 279 573 899 ; irect'on, Lane # E Volume Total 162 151 89 224 497 200 Volume Left 162 0 89 0 0 0 Volume Right .r r.. 0 151 0 0 0 200r°°. �. cSH 279 573 899 1700 1700 1700 1 � to Capacity 0.58 0.26 0,10 0.13 ' 0.29 0.12 AM Queue Length (ft) 84 26 8 0 0 0�; ��°�laY (s)'` 34.3 13.5 "'9.40.0 0.0 0.0 _.,_ .... . , ,,., _. ._. �. �.• Lane LOS D B A , , .,.„.,,,.� roach Delay (s) 24.3 2.7 0.0 , Approach LOS C Hie s Average Delay 6.4 �rii �lecI5 NMI x Analysis Period (min) �, �,,, 1 MMINI , „ 15 Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV.sy7 Future ConditionsPMDHV South Village 2008 No Build 04/13/2004 4 � I z Lane Configurations trol . ,,.: Stop Free Free Grade 0%' 0% 0% ON'ehlh} 101, 68 208 85 155 427.p� Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 0.88 246 100 183 505 _ `< Pedestrians II, Walking Speed (ft/s) %� Right turn flare Median storaqe veh platoon vC 1, stage 1 conf vol vCu, unblocked vol 1167 296 346 tC. 2 stage (s) p0 queue free % 34 89 85 i Volume Left 119 0 183 ili fi_ . ,tar, cSH 261 1700 1213 Queue Length (ft) 141 0 13 Lane LOS F A r F Approach LOS F Average Delay 10.5 Period (min) 15 Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV.sy7 Future ConditionsPMDHV South Village 2008 No Build 04/13/2004 ' ,, ..,. �.. ,�.:. ,�.: �iVB. �NBR r„�'g •.�; SBT"''SBR Lane Configurations 4 4 4+ +T+ Sigri'Control Stop Stop Stop Stop Volume (vph) 44 124 60 106 134 33 10 60 36 37 203 33 Peak Hour Factor 0.97 0.97 0.97 > 0,97 0.97 0.97 0.97 0,97 0.97 0.97 0.97 0.97 Hourly flow rate (vph) 47 133 64 114 144 35 11 64 39 40 218 35 Volume Total (vph) 244 293 114 293 Volume Left (vph) 47 114 11 40 �. Volume Right (vph) 64 35 39 35 Had1 (s) -0.09 0.04 -0,15 -0.01 Departure Headway (s) 5.5 5.6 5.8 5.6 009ree Utilization, x 0.37 0.45 0.18 0,46 Capacity (veh/h) 598 604 529 594 Coalelay (s) 11 8 1 3! 1 n 1 132 f Approach Delay (s) 1 1.8 13.1 10.1 13.2 Approac LC7S , . B B B B ' s.. Delay 12.4` "' " kW 'AgN..., . ,b" :,s_„ii HCM Level of Service B " Intersection Capacity Utilization 57A% ICU Level of Service B Analysis Period (min) 15 ., Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV.sy7 Future ConditionsPMDHV South Village 2008 No Build 04/13/2004 'e' 4- MLT. BR NBT- NBR SBL Lane Configurations r tT tt Idebl Flow (v 1900; 1900 1900 1900 1900 'phpl) 1900 G Lane Width 12 12 12 12 10 ,' as „.�,,. ",:... 14 Total Lost time (s) 4.0 '` 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 0.95 1.00 0.95 Frt 1.00 0:85 0,98 � 1,00 1.00 Fit Protected 0.95 1.00 1.00 0.95 .y� 1.00 Satd�ciw (rc5t 1770 1583 3473 1652 3775_ Flt Permitted 0.95 1.00 1.00 0.31 1.00 Satd. Flow (perm) 1770' 1583 3473 544 3775 ? fir. H �ry F Volume (vph) 188 84 677 96 132 1130 Peak-h'our factor, PHF - ' "0.96 �*U.96 0.'96 0.96 0.96' " 0.96 Growth Factor (vph) 104% 104% 104% 104% 104% 104% Flow (vph) 204 91 733 104 143 1224 RTOR Reduction (vph) 13 u u u K,ne Group Flow (vph) 204 - 20 824 _ 0 143 1224 Turn Type Perm Perm �oected`-Phases 8 ` 2 6 Permitted Phases 8 6 14ated Green, G (s) 11.2 11.2 31.4 31.4 31.4 Effective Green, g (s) 11.2 11.2 31.4 31.4 31.4 R fio 0.22 0.22 0.62 �`.,s .62 0.62 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 ' Vehicle Extension (s) 3.0 3.0 - 3.0 3.0 3.0 Lane Grp Cap (vph) 392 350 2155 338 2343 arls'Ratio Prot c0.12 0,24 c0.32 J "k v/s Ratio Perm 0.06 0.26 We^'Ratio 0.52 OM0,38 0,42 0.52 Uniform Delay, d1 17.3 15.5 4.8 4.9 5.4 Progression Factor 1.00 1.00 1,00 1 M 1.00 PbO�� ,, Incremental Delay, d2 1.2 0.1 0.1 0.9 0.2 18.6 ,15.6 4:9 5.8 56 Level of Service B B A A A 17.7 4.9 :. 5.6 st ;_M, Approach LOS B A „ A Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV.sy7 Future 2013 Conditions Without Project Future AM DHV 2013 No Build CO M^CO CV) South Village namRi,nna ruture conditions AMDHV 2008 C:\My Documentslsoburlingtonitraffic study12013 AMDHV.sy7 Future AM DHV South Village 2013 No Build neinQi3nnw v� co r CO �n v,,-243 74 T � Allen Rd � s i 1 8- G N := N� -,C L CU QD a ruture CondmonS AMUMV 1UUk$ C:Wy Documentslsoburlington\traffic study12013 AMDHV.sy7 Future AM DHV South Village 2013 No Build ndrnQignne Future uonamons AMDHV 2008 C:1My Documentslsoburlingtonitraffic study12013 AMDHV.sy7 Future AM DHV South Village 2013 No Build ndrnAignnd h �73 Barsto wRd y �lsa �-3s Ch 121 �;,. eese Factory Rd " `+•.�, Cn d) N I.- 0 C ruture 1—onaitions AIVIL)HV Z008 C:1My Documentslsoburlingtonitraffic study12013 AMDHV.sy7 Future Conditions AMDHV South Village 2013 No Build Future Conditions --* --I. i- -*-- 4-- 4\ Mod k.EIBT EBR WBIL WBT WIBR NBTT' NBIR BTU BR Lane Configurations t r t t t Ideal Flow (vphpl) 1900, 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lost time (s) 4.0 4.0 4.0 4.0 4,0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1,00 0.85 1.00 0,85 1.00 0.97 1,00 0.97:�IIIMM Fit Protected 0.98 1.00 0.99 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prat) 1701 1478 1718 1583 1770 1688 1711 2042 Fit Permitted 0.45 1.00 0.87 1.00 0.53 1.00 0.24 1.00 Satd. Flow (perm) 781 1478 1519 1583 993 1688 433 2042 Volume (vph) 55 69 111 128 405 145 310 342 82 21 158 44- Peak-hourfactor, PHF 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0,84 Growth Factor (vph) 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% Adi. Flow (vph) 71 90 144 166 526 188 402 444 106 27 205 57 RTOR Reduction (vph) 0 0 76 0 0 74 0 11 0 0 13 0 Lane Group Flow (vph) 0 161 68 0 692 114 402 539 0 27 249 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Actuated Green, G (s) 35,9 35.9 35,9 35,9 32.2 < 32.2 32,2 '32.2 Effective Green, g (s) 35.9 35.9 35.9 35.9 32.2 32.2 32.2 32.2 Actuated g/C Ratio 0.47 0.47 4 7 0A7 0.42 0.42 0.42 0.42 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3,0 Lane Grp Cap (vph) 368 v/s Ratio Prot v/s Ratio Perm 0.21 v/d Ratio 0A4 Uniform Delay, dl Progression Factor Incremental Delay, d2 Level of Service Approach Delay (s Approach"IL6S 13.4 1.00 0.8 14.2 B 12.8 B 697 0.10 0.10 11-1 1.00 01 11.2 B 717 747 420 714 183 864 0,33 0. 131 c0-46 0.12 c0.40 0.06 0.97 0,15 0.96 015 0.15 0.29 H 19.5 11.4 21-3 18.6 13.5 14.4 1.00 1 M 1.00 1.00 �'w 1.00 1.00 25.0 0.1 32.7 4.6 0.4 0.2' 44.5 11.5 54.0 23.2, KIN D B D C B B 37.5 'M D D B Af "'AFMON-11 HCM Average Control Delay 31.1 HCM Level of Service C WOM Volume to Capacity ratio 0.96 Actuated Cycle Length (s) 76.1 Sum of lost time (s) 8.0 .Action Capacity Utilization 82.3% ICU Level of Service E Analysis Period (min) 15 c Critical Lane Group Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C-.\My Documents\soburlington\traffic study\2013 AMDHV.sy7 Future Conditions AMDHV South Village 2013 No Build Future Conditions 'NBT,,', SBT SRR .,.;..; Lane Configurations t t r Sign Control Stop Free Free r& Grade 0% 0% 0% Volume (veh/h) 92 35 199 505 162 142<,,,... M Peak Hour Factor 0.91 0.91 0.91 0.91 0.91 0.91 r4low rate (vph) 110 42 238 605 194 170 Pedestrians Lane �dth (ft) �. .,.:�saav Walking Speed (ft/s) P lockage �5�WO '. Right turn flare (veh) fA d.. ,. , Median type None` `� Median storage veh) Upstream signal (ft)AIR -DX, platoon unblock(,, ' vC conflicting volume 1276 194 "364 "fS°� vC1, stage 1 conf vol vC2 stage 2 conf vof�t� t ` x t� m"","Od vCu, unblocked vol 1276 194 364 sv#P„ds, u'S, , n,., gyp'°ni rs3 tC, single (s) 6.4 6.2 4.1 tC, 2 stage (s) IF (s) 3.5 3.3 2.2 p0 queue free % 25 95 80 cMcapacity (veh/h) 147 847' 1194 Lane # EB 1: EB2 NB Volume Total 110 42 238 605 194 170 Volume Left 110 0 238 0 0 0 Vgtume;Right 0 42 0 0 0 170 � cSH 147 847 1194 1700 1700 1700 Volume to Capacity 0.75 0.05 0.20° 0,36 0.11 0.10: Queue Length (ft) 113 4 19 0 0 0 Control Delay (s) 79.7, 9.5 8.8 0.0 0.0 0.0 Lane LOS F A A 4?to Ch""belay(s) 60.3 2.5 0.0 Approach LOS F fflj�o. __.. n ., Average Delay 8.3 Iri , r�, 0� .u..x,.r' 4L2% ICU Level of'Service A t Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C-.\My Documents\soburlington\traffic study\2013 AMDHV.sy7 Future Conditions AMDHV South Village 2013 No Build Future Conditions M6Qffi_ t WBL ° WBR NBT NBR SBL SBT Lane Configurations T+ Sign Control Stop Free Free A:....f�' Grade 0% 0% 0% Volume (vehlh) 73 170 506 106 53 170 Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 0.88 Hourly flow rate (vph) 90 211 627 131 66 211 Pedestrians �,.�.�a.,. ,, M Lane Width (ff)W� ,r � �°. Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type None;" �.. v Median storage veh) Upstream signal (ft) <. pX nlatronn ! nblockcd vC,--conflicting volume 1034 692 758 vC 1, stage 1 conf vol ' vC2, stage 2 conf vol ,, • ,, r ;�«, , vCu, unblocked vol 1034 692 758 tC, single (s) % 6.4 6.2 4.1 < tC, 2 stage (s) tF (s) ., a 3.5 3.3 t p0 queue free % 62 53 ..s 92 M.caPacity (veh/h) ,.,,,n . 237 ._ r4 Volume Total 301 758 276 Volume Left 90 0 66 Volume Right 211 131 0- cSH 352 1700 853 Volume to Capacity 0.86 045 0.08' Queue Length (ft) 198 0 6 .. s7' (s ), 53.4 0.0 2.9 p , Lane LOS F A relay (s) 53.4 0.0 2.9 Approach LS F Average Delay w �W 12.6 Intersection Capacity Utilization 74 Analysis Period (min)` 15 r: Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV.sy7 Future Conditions AMDHV South Village 2013 No Build Future Conditions Lane Configurations, 4 Sign Control Stop Stop Stop Stop Volume (vph) 34 111 10 32 145 67 42 235 94 37 50 14 Peak Hour Factor 0,84 0.84 0.84 0.84 0,84 0.84 0.84 9.84 0.84 0.84 0.84 0.84 Hourly flow rate (vph) 44 144 13 42 188 87 54 305 122 48 65 18 3j�,Lane# .. EB 1 WB I NB '11 'W809,_,.,-� Volume Total (vph) 201 317 481 131 Volume Left_(vph) 44 42 55 48 5�ijj�� Volume Right (vph) 13 87 122 18 �t+v1j"(S) � 0:04' -0:10 -0.10 0A2 Departure Headway (s) 6.5 6.1 5.8 6.6 utilization, x 0.37 0.54 0.77 024 Capacity (veh/h) 477 542 605 459 (s) 13.3 16.1 25..4 11.7 a Approach Delay (s) 13.3 16.1 25.4 11.7 ,.,..M.., ... . Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV.sy7 Future Conditions AMDHV South Village 2013 No Build Future Conditions Lane Configurations r tT+ tt Deal Flov+r (vph ' .Ip 1900 1900 1900 1900 1900 *600 Lane Width 12 12 12 12 10 .. 14 (,°:0 4:0 4.0 4.0 4.0WWI �.Iwv Lane Util. Factor 1.00 1.00 0.95 1.00 � 0.95 0.85 098 1.00 '1.00;. M M Fit Protected 0.95 1.00 1.00 0.95 1.00 Ltd Flgw (prot) 1770 1583 3479 1652 3775 x y �� Fit Permitted 0.95 1.00 1.00 0.14 .. 1.00 Satd. Flow (perm) 1770 1583 3479 235 3775 Volume (vph) 160 223 1096 140 87 619 Peak -hour factor, PHF 0.95 0.95 0.95 0.95 0,95 - 0,95 " Growth Factor (vph) 109% 109% 109% 109% 109% 109% Adj. Flow (vph) 184 256 1258 161 100 710T RTOR Reduction (vph) 0 64 14 0 u 0. Lane Group Flow (vph)'` 184 192 1405 0 100 710 Turn Type Perm Perm Protected Phases 8 2 6 Permitted Phases 8 6 Actuated "Green, G (s) 11.2 112 34.2 34.2 34.2 Effective Green, g (s) 11.2 11.2 34.2 34.2 34.2 Actuated g/C Ratio 0.21 0.21 0.64 0.64 0.64 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 =' Lane Grp Cap (vph) 371 332 2228 151 2418 v/s Ratio*ot 0.10 0.41 0.19 v/s Ratio Perm 0.16 c0.43 v/c'Ratio '' 0.50 0.58 0.63 0.66 0.29 Uniform Delay, dl 18.6 19.0 5.8 6.0 4.3 " C 'ton Factor 1.00 1:00 1,00 1.00 1.00" Incremental Delay, d2 1.0 2.4 0.6 10.4 0.1 e � A 19.7 ,. �� bay-' � 21 4 6.4 15.4 4.3 ; �. ��;� Level of Service B e C A v B �a�1, ,n,.�, � ,,,� ��.�rn�..�ti „ A Approach Delay (s) 20.7 6.4 9 ° _; .; . , u� Approach C A A /yLOS�yy t3S+t1'IVMriN.7�,"a b%":, yr8 HCM Average Control Delay 8.6 HCM Level of Service A HCM Volume to Capacity ratio 0,69 Actuated Cycle Length (s) 53.4 Sum of lost time (s) 8.0 Intersection Capacity Utilization, 62.8% ICU Level of Service ` �� 1 Analysis Period (min) 15 c Critical Lane Group A _ m Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV.sy7 Future PMDHV South Village No Build 2013 04/08/2004 L _Q ..c N CO co V,g2 I� r- J L1--205 Aden Rd 040 pc- � 150 T 00 CO N t co co L cu Q co Exisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic study12013 PMDHV.sy7 Volumes Future PMDHV South Village No Build 2013 041OR1200A N C i I L Q) iL rII- 74 --110 N � Barstow Rd L Q) Q c Exisiting Conditions PMdhv C:1My Documentslsoburlingtonitraffic study12013 PMDHV.sy7 Volumes Future PMDHV South Village No Build 2013 04/08/2004 4� co L- QL CO N 0) o `— M 70 139 423 y rn^ Cv Nor- Exisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic study12013 PMDHV.sy7 Volumes Future PMDHV No Build 2013 Barstow Rd Exisiting Conditions PMdhv South Village 04/08/2004 ¢) Lco O Q �o ^ � �CN �36 (y �146 _ h .E ?se Factor y Rd 65-\ <<nrn CO C:1My Documentslsoburlingtonitraffic study12013 PMDHV.sy7 Volumes Future ConditionsPMDHV South Village 2013 No Build 04/08/2004 Movement ... """g%�EBT EBR -WBL WBT' WBR ::- NBL =`NBT-;``NBR SBL SBT ::SBR Lane Configurations t t r 1 t ►� t Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Totes Lost turt� r �� ''4.0 4.0 4.0 '' 4.0 4.0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1 .00 1.00 1.00 1.00 1.00 0.85 1.00 0.85 1.00 0.94 1.00 0.96 Flt Protected 0.99 1.00 0.97 1.00 0.95 1.00 0.95 1.00 S�td � low (prot) , .}x .,; ` 1726 1478 1691 1583 1770 1626 1711 2036 Flt Permitted 0.92 1.00 0.55 1.00 0.34 1.00 0.52 1.00 1595 1478' 955 '1583 627 1626 931 2036 Volume (vph) 36 201 388 144 113 45 201 159 121 93 360 113 hour factor, PHF 0.93 0.93 0.93 0,93 0,93 0.93_ 0.93 0,93 0.93 0,93 0.93 0.93 Growth Factor (vph) 109% 109% 109% 109% 109% 109% 109% 1091yo 109% 109% 109% 109% Adj ". low (vph) 42 236 455 169 132 53 236 186 142 109 422 132 RTOR Reduction (vph) 0 0 242 0 0 35 0 32 0 0 13 0 Lane Group Flow (vph) 0 278 213 0 301 18 236 296 0 109 541 0 Turn Type custom custom Perm Perm Perm Perm f:> pgtPhases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 '°�en,>(s) 24.3 24.3 24.3 24.3 '' 39.4 39.4 39.4 39.4 Effective Green, g (s) 24.3 24.3 24.3 24.3 39.4 39.4 39.4 39.4 �Ratio 0,34 0.34 0,34 0,34 0.55 0.55 0.55 0:55 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Ve11„ �sion (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 , 3.0 Lane Grp Cap (vph) 541 501 324 536 345 894 512 1119 v/s Ratio Prot 0.20 0.27 v/s Ratio Perm 0.17 0.31 c0.32 0.03 c0.38 0.12 v/c k bo 0.51 0.43 ` 0.93 0.03 0.68 0.33 0.21 0.48 Uniform Delay, d1 19.0 18.3 22.9 15.8 11.7 8.9 8.2 9.9 Progression Factor 1,00 1.00 s 1.00 1.00 1,00 1.00 1,00 1.00 = Incremental Delay, d2 0.8 0.6 31.8 0.0 10.5 1.0 0.9 1.5 Delay, 19.8 r -18.9 54.6 15.9 22.2 9.9 9.2 11 A Level of Service B B D B C A A B �;7, 0Y (s).. -..-, 1. ��`.. ��..'' 48.8 15.0 11.0 Approach LOS . B D B B HCM Average Control Delay 20.4 HCM Level of Service C HCM Volume to Capacity ratio ' 0.78 5; Actuated Cycle Length (s) 71.7 Sum of lost time (s) 8.0 Intersection Capacity Utilization" 82.5°!o ICU Level of Service Analysis Period (min) 15 c Critical Lane Group`' ' ; angms' Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV.sy7 Future ConditionsPMDHV South Village 2013 No Build 04/08/2004 Lane Configurations t t rr Free Free Grade 0% 0% 0% Vol 138 r:: 81 205 454 183,WIN. I I W11wr Peak Hour Factor 0.95 0.95 0.95 0.95 0.95 0.95 Hourly flow rate (vph) : 93 235 521 210` Pedestrians RONM16 Walking Speed (ft/s) Perms""lockage Right turn flare (veh) "Op type Nona k, Median storage veh) U sjr m_signal (fit) a pX, platoon ur.black- -d W.� (sting volume 942 521 731 . ` �` ' ' as>; . vC1, stage 1 conf vol vC2, stage 2 conf vol 1 `L� vCu, unblocked vol 942 521 731 ,. o�Vu�fY3 „4tA;S.. fl .X . ..4,55 Ek'� fWi, is �� •. ,i!.. s,. }N... tC, single (s) 6A 6.2 4.1 tC, 2 stage (s) tF' r 3.5 3.3 2..2 177, p0 queue free % 35 71 89 cM" capa� ty..(`!ah/h} voturne t otai Volume Left ght cSH Fes£ to Capacity Queue Length (ft) '..elay (s) Lane LOS ;` ,Aeiay (s) Approach LOS 170 158 93 235 5 . 170 0 93 0 0 0 158 0 0 0 261 555 873 1700 1700 0.65 ` 0.29 0.11 0.14 0.31 103 29 9 0 0 41.3'< 14.0 9.6 0.0 0.0 E B A 28.2 s_k.. 2.7 D 0 210 1700 0.12 0.0 0.0x Average Delay 7.3 Interspctton Capacity Utilization 49.9% ICU Level of,Service '. t"IM Analysis Period (min) 15" Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV.sy7 Future ConditionsPMDHV South Village 2013 No Build 04/08/2004 4,- 4-- I !* �► mw, MUM Lane Configurations Sir Control Free FreeWON Grade 0% 0% 0% ume SY,/h a Ph ..:.:. 101 6$ " " ... 208 85 155 iv. Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 0.88 w� Uii�ibV1! f_ 8 =y 258 105 192 529 "1"Ar Pedestrians ne th ft Walking Speed (ft/s) Right tum flare Median pX, platoon unblocked vC 1, stage 1 conf vol vCu, unblocked vol 1223 310 ___ 363 R. Volurne Total" AWt Volume Left 125 0 192 ,�fight ; .:,:. 84' 105 4 cSH 241 1700 1196 to Capaot 0 87 0.21 0.1 Queue Length (ft) 177 0 14 jay (s) Lane LOS F A :Delay(s)', 72.2 0.0 3.8 Approach LOS F r Average Delay 13.8 Period (min) 15 Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV.sy7 Future ConditionsPMDW South Village 2013 No Build 04/08/2004 Mnvemen# .> y, EBL 'm EBT ,` EBF2 `- WBL WBT' WBR NBI , °y`NBT NBR . ;,SBL ` ::SBT >':SBR Lane Configurations 4 4+ - 4 +T+ �(T ontrol Stop Stop Stop Stop' Volume (vph) 44 124 60 106 134 33 10 60 36 37 203 33 F a fI�actor 0.97 0.97 0.97 0 97 0.97 0.97 0.97 0.97 ` 0.97 0,97 0.97 0:97 Hourly flow rate (vph) 49 139 67 119 151 37 11 67 40 42 228 37 :..... : ; ,... -:: ` . Et ,1 , W B".1 .; NB 1 SB=. Volume Total (vph) 256 307 119 307 Vile Left (vph) 49 119 11 42 ^& Volume Right (vph) 67 37 40 37 .` a -0.09 0.04 -0.15 -0.01 ; Departure Headway (s) 5.7 5.7 6.0 5.7 Degree Utilization, x 0.40 0.48 ` 0.20 0.49 Capacity (veh/h) 583 591 509 580 Control Delay (s) 12.4 13.9 10 5 14.1 '. Approach Delay (s) 12.4 13.9 10.5 14.1 Approach h Delay. 13.2 HCM Level of Service B Intersection Capacity Utilization 59.5% lCU Level'of''Service B Analysis Period (min) 15 NEW !IBM. Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C-.\My Documents\soburlington\traffic study\2013 PMDHV.sy7 Future ConditionsPMDHV South Village 2013 No Build 04/13/2004 ,-- I',- Iv. # 1ltliuertient V111131- WBR I e Lane Configurations r tT Vi tt Ideal Flow (vphpl) 190Q 1900 1900 1900 1900 19003 Lane Width 12 12 12 12 10 14 ii !west time (s) 4:0 4.0 4.0 4.0 4.0,4H� Lane Util. Factor 1.00 1.00 0.95 1.00 0.95 Frt' 1.00 0.85 0.98 1.00 1.00>,< Flt Protected 0.95 1.00 1.00 0.95 1.00 atd Flew (prot) 1770 1583 3473 1652 3775' Flt Permitted 0.95 1.00 1.00 0.30 1 00 Satd. Flow (perm) 1770 1583 3473 515 3775,1910MMM.,k4.. _'1 Volume (vph) 188 84 677 96 132 1130 iarfactor, PHF " 0.96` 0.96 0`.96 096 0.96 0.96 AM Growth Factor (vph) 109% 109% 1091yo 109% 109% 109% Adj., Flow (vph) 213 95 769 109 150 1283 RTOR Reduction (vph) 0 74 i3 0 0 0 Larne Group Flow (vph) 213 21 865 0 150 1283 Turn Type Perm Perm Protected Phases $ 2 6 P `, Permitted Phases 8 6 Actuated Green,'G (s) 11.7 11.7 33.2 33.2 33.2 Effective Green, g (s) 11.7 11.7 33.2 33.2 33.2 Actuated g/C Ratio 0.22 0.22 0.63 0.63 0.63 �r Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 4 F3,0 3.0 3.0 3 0 Lane Grp Cap (vph) 391 350 2180 323 2369 v/s'Ratio Prot c0.12 0.25 c0.34 v/s Ratio Perm 0.06 0.29 v/c' Ratio 0.54 0.06 0.40 0.46 0.54 Uniform Delay, d1 18.2 16.3 4.9 5.2 5.6 Progression factor 1.00 1.00 1,00 1.00 1,00 Incremental Delay, d2 1.6 0.1 0.1 1.1 0.3 Delay (s) 19.8 16.3 5.0 6.2 5.8. t Level of Service B B A A A Approach Delay (s) 18.7 5.0 . ;.. 5.9 Approach LOS B A A HCM Average Control Delay 7.1 HCM Level of Service A HW' olume to Capacity'ratio ' 0.54 .. ... Actuated Cycle Length (s) 52.9 Sum of lost time (s) 8.0 Intersection Capacity; Utilization 53.1 %' ICU Level of Service r A Analysis Period (min) 15 c Critical Lane Group �'MO O Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV.sy7 Future 20OR... Conditions. With Project Future AMPKHR 2008 Build South Village namR12nna ruture Uonclitions AMDHV 2008 CAMy Documentslsoburlingtonitraffic study12008 AMDHV Build.sy7 Volumes Future AMPKHR South Village 2008 Build 0amRl9nna L �^Q vJ N o ce) `\l 81 �--76 Co L� cu N 0- Future Conditions AMDHV 2008 CAMy Documentslsoburlingtonitraffic study12008 AMDHV Build.sy7 Volumes Future AMPKHR 2008 Build South Village 04/08/2004 Future Conditions AMDHV 2008 CAMy Documents\soburlington\traffic study12008 AMDHV Build.sy7 Volumes Future AMPKHR 2008 Build '\-70 "�--154 Cheese �r 00 South Village 04/08/2004 FactoRry d ruture c:onaitions AMDHV 2008 CAMy Documentslsoburlingtonitraffic study12008 AMDHV Build.sy7 Volumes Future AMPKHR South Village 2008 Build 04/08/2004 Future Conditions AMDHV 2008 CAMy Documents\soburlington\traffic study\2008 AMDHV Build.sy7 Volumes Future Conditions AMDHV South Village 2008 Build 04/14/2004 EBR WBL WBT lVBR NBL' NBT NBR » SBL SBT 5BR Lane Configurations fi r t r t t ifs `"'„phpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 "1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 0 ilw© I e N 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0' Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1,00 0.85 1 00 0.85 1,00 0.97 1,00 _0.97 Fit Protected 0.98 1.00 0.99 1.00 0.95 1.00 0.95 1.00 Satdlcxn! (prot)' 1701 1478 1716 1583 1770 1688 1711 2050 Fit Permitted 0.45 1.00 0.86 1.00 0.51 1.00 0.18 1.00 8atd. Flow (perm) 790 1478 1498 1583 959 1688 333 2050_ Volume (vph) 55 69 128 147 405 145 363 402 96 21 182 44 Peak-hourfactor, PHF 0.84 0.84 0.84 0.84 084 0.84 0.84 0.84 0.84 0.84' 0.84`` 0.84 Growth Factor (vph) 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% Ad}'. Flow (vph) 68 85 158 182 501 180 449 498 119 26 225 54 RTOR Reduction (vph) 0 0 84 0 0 72 0 11 0 0 11 0 Lane Group Flow (vph) 0 153 74 0 683 108 449 606 0 26 268 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 g Permitted Phases 4 4 4 8 8 2 6 Actuated Green, G (s) 36.9 36.9 36.9 36.9 34.0 34.0 34.0 34.0 Effective Green, g (s) 36.9 36.9 36.9 36.9 34.0 34.0 34.0 34.0 Actuated g/C Ratio , 0.47' 0.47 0.47 0.47 0.43 0,43 0.43 0,43 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s). U ,p 9 : 3,0 10 ,23.0 3.0 3.0 3.0 310. 3,0. Lane Grp Cap (vph) 369 691 701 740 413 727 143 883 v/s Ratio Prot 0.37 0.14 v/s Ratio Perm 0.19 0.11 c0.46 0.11 c0.47 0 08 v/c Ratio 0.41 0.11 0,97 0,15 1.09 0.83 0.18 0.30 Uniform Delay, d1 13.9 11.8 20.5 12.0 22.5 19.9 13.9 14.7 Prcigression' Factor C 1.00' 1.00 �< 1 m 1.00 1.00 �1.00 1.00 1.00 Incremental Delay, d2 0.8 0.1 27.5 0.1 69.8 8.2 0.6 0.2 14.6' 11.8°" 48'.0 12.1 92.2 28.1 14.5 14.9 Level of Service B B D B F C B B t,;,.i : 40.5 55.1 14.9 Approach LOS B D E B , HCM Average Control Delay 40.2 HCM Level of Service OWN= D HCM Volume to apacity ratio 1.03�`,.;: Actuated Cycle Length (s) 78.9 Sum of lost time (s) 8.0 Capacity Utilization 84.6% ICU Level of Service Efi .., Analysis Period (min) 15 Grfical'-Lane Group Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV Build.sy7 Future Conditions AMDHV South Village 2008 Build 04/14/2004 1 - '1- I Mo` BLm .::BT~ EBR,;: WBL WBT `WBR BR Lane Configurations T+ T T+ r Ideal Flow (vphpl) 19g °'" 900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 12 12 14 12 12 12 10 13 12 12 12 12 19, It, 4 Lme.(s) 4.0 p 4.0 4.0 4:0 4.0 4.0 .4.0 Lane Util. Factor 1.00 .. 1.00 ,:.: r, 1.00 1.00 1.00 1.00 1.00 1.00 Frt _ 1.00 0.90 1.00 0.89 1.00 1.00 I 1.00 0:85 Flt Protected 0.95 1.00 0.95 1.00 0.95 1.00 0.99 1.00 Satd. Flow (prot); 1770 1684 1770 1650 1652 1921 1841 1583 Flt Permitted 0.95 1.00 0.72 1.00 0.60 1.00 0.81 1.00 Satd. Flow.(perm) 1770 1684 1332 1650 1037 1921 1501 1583 Volume (vph) 92 18 36 23 27 86 206 527 7 47 168 151 Peak -hour factor, PHF 0.91 0.82 0.91 0.82 0.82 0.82 0.91 0,91 0.82 0.82 0,91 0,91 Growth Factor (vph) 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% Adj FJQw (yp0) 105 23 41 29 34 109 235 602 9 60 192 173 RTOR Reduction (vph) 0 35 0 v 96 0 0 0 0 0 0 80 lane"Group Flow (vph) 105 29 0 29 47 0 235 611 0 0 252 93 Turn Type Split Perm Perm Perm Perm Protected Phases 4 4,;` 8 2 6 Permitted Phases 8 2 6 6 A�d Green, G (s) 7.9 7.9' x,° 6.7 6.7 31.1 31.1 31.1 31.1 Effective Green, g (s) 7.9 7.9 6.7 6.7 31.1 31.1 31.1 31.1 %jed g/C Ratio F ,.u, 0.14 0.14- 0.12 0.12 0.54 0.54 0.54 0:54 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 icle Extension (s) 3.0' 3.0 M,, ' 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 242 231 155 192 559 1035 809 853 Ws Ratio Prot c0.06 0,04 c0.09 c0 32'MUMMMOMP v/s Ratio Perm 0.02 0.23 0.17 0.11 V16,`R - 0, 0.43 0,12 0,19 0.24 0.42 0.5 0.31 0.11 Uniform Delay, dl 22.8 21.9 23.0 23.2 7.9 9.0 7.4 6.5 Progression Factor 1,00 1`.00 1.00 1.00 1.00 1.00 1.00 1.00 Incremental Delay, d2 1.2 0.2 0.6 0.7 0.5 0.9 0.2 0.1 ' 24.1 22.1 23.6 23.9 8A 9.9 a � 9' 7.6 6.6 Level of Service C C C C A A A A .. Approach Delay (s} 23 3 23 8 9.5 ;7.2 Approach LOS C C A A HCM Average Control Delay 11.8 HCM Level of Service B ..N<. Capacitj, ratio Actuated Cycle Length (s) 57.7 Sum of lost time (s) 12.0 106966'ri ac y t lizatt 1 ��: gp Y��'F Analvsis Period (min) 4s.--:"HIM, 15 f� P9., Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV Build.sy7 Future Conditions AMDHV South Village 2008 Build 04/14/2004 L",,,,WBR NBT NBR--','�' Lane Configurations T+ *T Sign C(�trol' Stop Free FreeEs Grade 0% 0% 0% Volumej( h/h) 73 174 517 106 61 194 Peak Hour Factor 0.88 0.88 0.88 0-88 0.88 0.88 to (vph) 86 206 611 125 72 229-J,,M,#AV p Pedestrians n'' Width (ft) L e -4 RAIN I Walking Speed (ft/s) P&dent Blockage Right turn flare (veh) 'filijiliffNI ia6 type i5n Median storage veh) m signal (ft) 441 pX, platoon unblocked cctieting volume 1047 674. M� 36 m vC1, stage 1 conf vol stake 2 conf vol vCu, unblocked vol 1047 674 736 1 le (s) 6.4 6.2 MEL tC, 2 stage (s) 3.5 33 pO queue free % 63 55 92 Volume Left 86 0 72 ht 206 125 1 cSH 354 1700 869 to Capacity 0.82 0.43 0.08 Queue Length (ft) 182 0 7 b6htrbl Delay (s) 481 0.0 3,0 ABM Lane LOS E A Approach Delay (s) 48.7 '0.0 3.0 Approach LOS E Average Delay 11.4 Intersection Capacity Utilization 74.5% ICU Level of Service A, RR Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV Build.sy7 i i Future Conditions AMDHV South Village 2008 Build 04/14/2004 All ;. WON MW , Lane Confiqurations Volume (vph) 36 116 11 32 148 67 43 235 94 37 50 14 U.84 0:$4,U.84 ,0 84 Hourly flow rate (vph) 45 144 14 40 183 83 53 291 116 46 62 17 Fs v Volume Total (vph) 202 306 461 125 Volume Right (vph) 14 83 116 17 6.4 6.0 5.7 6.5 Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C-.\My Documents\soburlington\traffic study\2008 AMDHV Build.sy7 Future Conditions AMDHV South Village 2008 Budd 04/14/2004 4r- 4-- _. Lane Configurations tt Ideal Flow (vphpl) 1900 1900 1900 ` 1900 1900 1900� Lane Width 12 12 12 12 10 14 Tbtal't& tame (s) 4.0`` 4`.0 4.0 4.0 4.0'� � Lane Util. Factor 1.00 1.00 0.95 1.00 0.95 Frt 1.00 0.85 0.98' 1.00 1.00 Fit Protected 0A5 1.00 1.00 0.95 1.00 Satd. Flow (prot) 1770' ' 1583 3475 1652 3775 Fit Permitted 0.95 1.00 1.00 0.15 1.00 Satd. Flow (perm) 1770 ' 1583 3475 253 3775 ,. <,,... :s ..,.... ,.:_ ,r ....... Volume (vph) 177 248 1096 152 96 619 Peak -hour factor, PHF 0.95 0.95 0.95 0,95 0.95 0.95 v Growth Factor (vph) 104% 104% 104% 104% 104% :. 104% �Y...f, ..._.. v. Adj. Flaw (vph) 194. 271 1200 166 105 678 RTVn neductlon (vph) 0 72 16 0 0 0 Lane Group Flow (vph) 194 199 1350 0 105 678 Turn Type Perm Perm -�'t tedff �` eases 8 2 6 Permitted Phases 8 6 Actuated Green, G (s) 11.2 11.2 32.7 "32.7 32.7 Effective Green, g (s) 11.2 11.2 32.7 32.7 32.7 Actuated g/C Ratio 0.22'< 0.22 0.63 0.63 063 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s), 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 382 342 2189 159 2378 atio Prot 0.11 0,39 0.18 5 v/s Ratio Perm 0.17 c0.42 a 2atio 0.51 0,58 0.62 0,66 0,29 6 Uniform Delay, d1 17.9 18.2 5.8 6.1 4.3 Prod*sion Factor 1,00 1.00 1.00 -1,00 1.00 Incremental Delay, d2 1.1 2.5 0.5 9.8 r z 0.1 a k & ... Delay (s) 19.0 `' 20.8 6.3 15.9 4.4 = ,. ',.,� WIN Level of Service B C A B . A Approach Delay (s) 20.0' 6.3 5.9 �m'a.tgg��S Approach LOS C A .� ..� a, ,,, A d4t4wA AesXki+tc. WORF-9-M OR HCM Average Control Delay 8.6 HCM Level of Service A HCM Volume to Capacity ratio 0,69 :� . , , Actuated Cycle Length (s) 51.9 Sum of lost time (s) 8.0 „ . n Capacity Utilisation 62.3% ICU Level of Service "' Analysis Period (min) 15 . . ! r one Croup x,g. ..., Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 AMDHV Build.sy7 Future PMDHV South Village Build 2008 04/08/2004 Exisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic study12008 PMDHV Build.sy7 Volumes Future PMDHV South Village Build 2008 0410R/2004 txisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic study12008 PMDHV Build.sy7 Volumes Future PMDHV Build 2008 South Village 04/08/2004 I&— CO Q) O Q M `y co '\-34 I(—_145 4`""'�•�-.. Cheese F 132� •� acto �'110ry Rd 64 CO CO Exisiting Conditions PMdhv CAMy Documents\soburlington\traffic studyk2008 PMDHV Build.sy7 Volumes Future PMDHV South Village Build 2008 04/08/2004 L cu vJ LO (D �78 o 00 d-00 N I— ca Q) Q CO Exisiting Conditions PMdhv C:\My Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Volumes Future PMDHV South Village Build 2008 04/OR/2004 N L -Q v! LO Lr) c�Jg7 A// en R CD cv a� L -lam r� r Exisiting Conditions PMdhv CAMy Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Volumes Future ConditionsPMDHV South Village 2008 Build 04/14/2004 �Silc me EBL' " EBT EBR WBL WBT ` WBR NBL NBT NBR ' SBIL SBT; SBA Lane Configurations t r T r ►j t t !.deal„_Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900_ 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 ' f ost time (s) 4,0 4.0 4.0 4.0 4,0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.85 1.00 0.85 1.00 0.94 1.00 0,97 Fit Protected 0.99 1.00 0.97 1.00 0.95 1.00 0.95 1.00 SaidP(ov"(prot) 1726 1478 1689 1583 1770 1626 1711 2042 Flt Permitted 0.92 1.00 0.56 1.00 0.32 1.00 0.48 1.00 Satd.;Flow erm) r, <. 1596 1478 977 1583 589 1626, . , 871 _-2042 Volume (vph) 36 201 437 161 113 45 234 185 141 93 404 113 Peak -'hour factor, PHF `' 0,93; 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0:93 0.93 0.93 0.93 Growth Factor (vph) 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% Adj. Flow (vph) 40 225 489 180 126 ` 50 262 207 ` 158 104 452 126 RTOR Reduction (vph) 0 0 222 0 0 33 0 32 0 0 12 0 Lane Group Flow (vph) 0 265 267 0 306 17 262 333 0 104 566 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Actuated Green,°G (s) 24,7 24.7 24.7 "` 24.7 39:3 39.3 39.3 39.3 Effective Green, g (s) 24.7 24.7 24.7 24.7 39.3 39.3 39.3 39.3 Actuated g/C Ratio 0.34 0.34 034 0.34 0.55 0.55 0.55 0.55 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension , s 3.0 3.0 3.0 10 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 548 507 335 543 321 888 475 1115 v/s Ratio Prot 0229-13 0.28 v/s Ratio Perm 0.17 0.33 0.31 0.03 c0.44 0.12 v/c Ratio 0.48 0.53 0.91 0.03 0.82 0.38 0.22 0.51 Uniform Delay, d1 18.6 19.0 22.6 15.7 13A 9.3 8.4 10.3 Progression Factor 1.00 1.00 1.00 1.00 1,00 1.00 1.00 1.00 Incremental Delay, d2 0.7 1.0 28.2 0.0 20.0 1.2 1.1 1.7 PMMMZ5 19.3 20.0 50.8 15.7 33A 10.6 9.5 11.9 Level of Service B B D B C B A B M' ' elay (s) .r;Fz;. 19.7 45.9 aE', ; 20.1 11.6 Approach LOS B D , C B HCM Average Control Delay 21.4 HCM Level of Service C HCM Volume to Capacity ratio 0,87 Actuated Cycle Length (s) 72.0 Sum of lost time (s) 8.0 °'ction Capacity Utilization 84.6% ICU Level of Service E Analysis Period (min) 15 ��""Lane' Group Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2008 Build 04/14/2004 Lane Configurations T T T+ *T r Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 - 1900 - 1900 1900 Lane Width 12 12 14 12 12 12 10 13 12 12 12 12 Total Lost time (s) 4.01 4.0 4.0 4.0 4.0 4.0, 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1 M 0.88 , , 1.00 0.88 1.00 0.99 1.00. 0.85 Fit Protected 0.95 1.00 0.95 1.00 0.95 1.00 0.99 1.00 Satd, Flow (prot) 1770 1634 , 1770 1632 1652 ; 1902 'v, .1850 1583 Fit Permitted 0.95 1.00 0.91 1.00 0.30 1.00 0.92 1.00 Satd. Flow (perm) 1770 1634 >'' 1693 1632 516 1902 1715 1583 Volume (vph) 155 30 139 18 13 64 92 215 18 76 477 188 Peak -hour factor; PHF 0.95 0.92 0.95 "0.92 0.92 0.92 0.95 6.05 0,92 0.92 ' 0;95' 0.95 Growth Factor (vph) 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% 104% Adi. Flow,(vph) 170 34 152 20 .15 72 101 235 20 86` 522 206 RTOR Reduction (vph) 0 124 0 0 67 0 0 3 0 0 0 91 Lane Group Flow (vph) 170 62 0 20 20 0 °101 252 0 0 608 '116 Turn Type Split Perm Perm Perm Perm Protected Phases 4 4 8 2 6 Permitted Phases 8 2 6 6 Actuated Green, G (s) ; 10.6, 10.6 " 4.4 -4A 30.8 30.8 30:8 30.8 Effective Green, g (s) 10.6 10.6 4.4 4.4 30.8 30.8 30.8 30.8 ActutdpA fC Ratio 0.18 . 0.18 �" 0.0$ 0.08 0.53 0.53 0.53 0.53 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Vel j �h (s) 3.0 " 3.0 3,.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 325 300 129 124 275 1014 914 844 V , t►c Prot 0,10 ' c0.11 c0,05 0,13 v/s Ratio Perm 0.01 0.20 c0.35 0.13 irlc do 0,52 0.21 0.16 0.17 0,37 025 0,67 0,14 Uniform Delay, d1 21.3 20.0 25.0 25.0 7.8 7.3 9.8 6.8 ::egression Factor 1.00 1 A0 1,00 1`.00 1,00 1:00 1.00 1.00 Incremental Delay, d2 1.5 0.3 0.6 0.6 0.8 0.1 1.8 0.1 a `",air 1-0 22.8 20A 25.5 25,6 8.7 7A 11.6 6.9 Level of Service C C C C A A B A delay (s) .5 25.6 7.8 10.4 Approach LOS C C .. .. A ..', B HCM Average Control Delay 13.3 HCM Level of Service B V ' `me to Capacity ratio 0.66 Actuated Cycle Length (s) 57.8 Sum of lost time (s) 12.0 tiort Capacity Utilization ` 69.0% ICU Level of Service Analysis Period (min) 15 ..:,ae=Group .a. r, Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2008 Build 04/14/2004 WWI"WNW .�. .. .. _ :e.. ,10 ��.s. H,_-� �.. � N:fi3' "', mr' � � �`.�.,'-� �. Lane Configurations Y 1� +1 Sign Control Stop Free Free Grade 0% 0% 0% ;I Volume (veh/h)' 101 75 231 85 161 441 .. , �_�. Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 0.88 i4btu1[aulf to (vph) 119 89 273 100 190 521 , Pedestrians Larne Walking Speed (ft/s) Pet '' d Right turn flare (veh) Medtt-n'fYp None Median storage veh) signal, {ft} pX, platoon unblocked ',,J,ftJ ting volume 1225 323 373 vC1, stage 1 conf vol ,stage 2 conf vol vCu, unblocked vol 1225 323 373 IM,single (s) 6.4 ' 6.2 4.1} tC, 2 stage (s) 3.5 3.3, 2.2 5 p0 queue free % 28 88 84 M 'Capacity jveh/h 166 718 Volume Total 208 373 711 Volume Left 119 0 190 ryy Wume Right, 89 100 0 "Awl :.; cSH 247 1700 1185 Volume to Capacity 0.84 0.22 0.18 � Queue Length (ft) 169 0 14 I Delay (s) 66.7 0.0 3.8 j Lane LOS F A ,, ch Delay (s) 66.7 0.0 3.8=" Approach LOS F t♦E w E. S,.m. .,......o _^�„.eF,<-_, _ _ ". ,RI T__ _,xe ,.. e3ze Average Delay 12.8 lntersectron Capacity Utilization" 72.0°% ICU Level of Service C Analysis Period (min) 15 �.5 Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2008 Budd 04/14/2004 MINA,0G Lane Configurations Volume (vph) 45 127 62 106 139 33 11 60 36 37 203 34 >'eakcin (�97"M0A7 Hourly flow rate (vph) 48 136 66 114 149 35 12 64 39 40 218 36 Volume Total (vph) 251 298 115 294 airffig" 12 40 ,.. Volume Right (vph) 66 35 39 36 Departure Headway (s) 5.5 5.6 5.9 5.1 f� K Capacity (veh/h) 595601 523 589 Approach Delay (s) 12.0 13.3 10.2 13.4 M Level of Service B MT W � zaod (min) 15 Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2008 Build 04/14/2004 t �- �► 1 . g _� Lane Configurations tT� tt Ideal Flow (vphpl) 1900 1900 1900 1900 1900 ` 1900 Lane Width 12 12 12 12 10 14 t time (s) 4.0' 40 4.0 4.0 4 0 ,, " MT Lane Util. Factor 1.00 1.00 0.95 1.00 Win` . 0.95 . � -;: KflSn P_ 4. 1.00 0.85 0.98 1.00 1.00 F a M . Is. M1en Fit Protected 0.95 1.00 1.00 0.95 1.00 ., SesM . "u� A", ow(prot)" 1770` 1583 3461 1652 ' 3775". Flt Permitted 0.95 1.00 1.00 0.31 1.00 . ", Flowberm) 1770 1583 3461 535 '' 3775 Volume (vph) 207 93 677 116 151 1130 FF? hour factor, PHF 0.96 0.96 0.96 0.96 =0,96 Q.96 Growth Factor (vph) 104% 104% 104% 104% 104% 104% �#dj"ry flow (vph) 224 101 733 126 164 1224 RTOR Reduction (vph) 0 81 17 0 0 0 x. wcoup Flow (vph) 224 20 842 0 164 1224 Turn Type Perm Perm Protected Phases 8 2 6 Permitted Phases 8 6 / c uated Green, G (s) . 10.5 10.5 33.6 33.6 33.6 Effective Green, g (s) 10.5 10.5 33.6 33.6 33.6 uated:g/C Ratio 0.20 0.20 0.64 0.64 O.64 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 d 'l& Extension (s) 3.0 3.0 3.0 3.0 10 Lane Grp Cap (vph) 357 319 2232 345 2435 y/s Ratio Prot' c0.13 0.25 c0.32 v/s Ratio Perm 0.06 0.31 v'/ Ratio 0,63 0.06 0,38 0,48 0,50' Uniform Delay, d1 19.0 16.8 4.3 4.7 4 9 ',&Factor 1.00 1.00 1,00 1.00 1.001 Incremental Delay, d2 3.4 0.1 0.1 1.0 0.2 �} 22.4 16.9 4.4 5.8 5.0 ". w�f�N W4 Level of Service C B A A A IV' p' ch Delay (s) 20 4.4 5 1 Approach LOS C A A jntersection Summa' HCM Average Control Delay 6.9 HCM Level of Service A HCM Volume to Capacity ratio 0,53 Actuated Cycle Length (s) 52.1 Sum of lost time (s) 8.0 Intersection Capacity Utilization' 53.9% ICU Level of Service Arc Analysis Period (min) 15 c Critical Lane Group, Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2008 PMDHV Build.sy7 Future 2013 Conditions With Project Future AM DHV 2013 Build 00 I'll CC) �s8 �441 6p—,f cv M C-1)O South Village 04/08/2004 Future Conditions AMDHV 2008 C:1My Documentslsoburlingtonitraffic study12013 AMDHV.sy7 Future AM DHV 2013 Build South Village 04/08/2004 40 CO CV) r— CO --- Ze Ce z4 n tral Site Drive ve 39--\i to N � CO T co L- cu Future Conditions AMDHV 2008 C:1My Documents\soburlingtonitraffic study12013 AMDHV.sy7 IFuture AM DHV South Village 2013 Build 04/08/2004 L Q) 0- co O � CO 190 Z-�80 OWN d- c� W L cu Q� Q W Future Conditions AMDHV 2008 C:\My Documents\soburlington\traffic study\22013 AMDHV.sy7 Future AM DHV South Village 2013 Build 04/08/2004 �73 '<--161 3 �' �-35 Cheese � 2 s Factory s� r Rd ��o N (tn i OCD Future Conditions AMDHV 2008 C:1My Documentslsoburlingtonitraffic study12013 AMDHV.sy7 Future AM DHV South Village 2013 Build ndmRignna ruture conditions AMDHV 2008 C:\My Documents\soburlington\traffic study\2013 AMDHV.sy7 Future Conditions AMDHV South Village 2013 Build Future Conditions ---* --1' --* 'r I,- -C' move EBR WBL NBT-111-7,k`'NBR SBL SBT SBR Lane Configurations t if t t Vi t Ideal Flow, (yph'1) 1900 p 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lost time (s) 4,0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1,00 0.85 1.00 0.85 1.00 0.97 1.00 0.97 Flt Protected 0.98 1.00 0.99 1.00 0.95 1.00 0-95 1.00 Sat'd, Flow (prot) 1701 1478 1716 1583 1770 1688 1711 2047 Flt Permitted 0A1 1.00 0.86 1.00 0.51 1.00 0.16 1-00 $a,tO. Flow (perm) 718 1478 1495 1583 957 1688 289 2047 Volume (vph) 55 69 118 145 405 145 360 399 96 21 172 44 Pe6k-hour factor; PHF 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 0.84 Growth Factor (vph) 109% 109% 109% 109% 109% 109% 1091yo 109% 109% 109% 109% 109% Adj. Flow (vph) 71 90 153 188 526 188 467 518 125 27 223 57 RTOR Reduction (vph) 0 0 81 0 0 72 0 i 1 0 0 ii Lane Group Flow (vph) 0 161 72 0 714 116 467 632 0 27 269 Turn Type CUStOM CUStO111 Perm Perm Perin Perm -0 Protected Phases 8 2 Permitted Phases 4 4 4 8 8 2 6 A400"been, G (s) 37.0 37.0 37,0 37.0 34.0 34.0 34.0 34.0 Effective Green, g (s) 37.0 37.0 37.0 37.0 34.0 34.0 34.0 34.0 Actu ' ated g/C Ratio 0,47 0.47 0.47 0,47 0.43 0,43 0,43 0A3 Clearance Time (s) 4.0 4-0 4.0 4.0 40 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3A 3,0 3,0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 336 692 700 741 412 726 124 881 0.38 .14 0 v/s Ratio Perm 0.22 0.10 c0.48 0.12 c0.49 0-09 Mh; do 0A8 0.10 1.02 0.16 1.13 0.87 0.22 0.30 Uniform Delay, dl 14.4 11.7 21.0 12.0 225 20.5 14.1 148 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00' 1.00 1.00 Incremental Delay, d2 1.1 0.1 39.1 0.1 86.0 11-1 0.9 02 ' Deta Y, 4010 -1 " 15,5 11.8 60.1 121 108.5 31.6j§41111'' 15.0 14.9 Level of Service B B E B F C B B Delay (s) 13.7 50.1 64.0 15.0 Approach LOS B D E B NAMMM HCM Average Control Delay MR- 47.5 HCM Level of Service D 0, 01,11V lbiiie' to Capacity ratio 1.07 Q li Actuated Cycle Length (s) 79.0 Sum of lost time (s) 8.0 tersectton Capacity Utilization 87.1% ICU Level of Service _sue Analysis Period (min) 15 (cal Lane Group Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV Build.sy7 Future Conditions AMDHV South Village 2013 Build Future Conditions ---* -I. -;ii, ,f- .- 1- 4\ t ` \40- 1 EBR Wl3L' .WEST' WBR ,'_ "i�g`NBR "SBL' `SBT ,„SBR Lane Configurations T+ T+ Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 `" 1900 1900 1900 ' 1900 Lane Width 12 12 14 12 12 12 10 13 12 12 12 12 Total Lost time (s) 4.0 4.0 _4.0 4.0 4.0 4.0 4,0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1.00 0.90 1.00 0.89 1.00 ` 1.00 ` 1.00 0.85 Flt Protected 0.95 1.00 0.95 1.00 0.95 1.00 0.99 1.00 (prot) 1770 1683 1770 1651 a 1652 1921 1842 1583 Flt Permitted 0.95 1.00 0.71 1.00 0.59 1.00 0.79 1.00 Satd. Flow (perm) 1770 1683 1329 1651 1022 1921 1481- 1583 Volume (vph) 92 18 36 22 26 83 206 527 7 45 168 151 Peak -hour factor, PHF" 0,91 0.82 0.91 0,82 0,82 0.82 0.91 0.91 > 0.82 0.82 0.91 0,91 Growth Factor (vph) 109% 1091Y. 1091. 109% 109% 109% 109% 109% 109% 109% 109% 109% Adj. Flow tvnhl 1 1 Q 24 43 29 35 110 247 631 9 ' 60 201 181 RTOR Reduction (vph) 0 37 0 0 98 0 0 0 0 0 0 80 Lane Group Flow (vph) 110 30 0 29 47 0 247 640 0 0 261 101 Turn Type Split Perm Perm Perm Perm Protected Phases 4 4 8 2 6 Permitted Phases 8 2 6 6 Actuated Green, G (s) 8.2 8.2 6.7 "`6.7 83.7 33.7 33.7 333 Effective Green, g (s) 8.2 8.2 6.7 6.7 33.7 33.7 33.7 33.7 AcfWted g/C Ratio 0.14 0.14 0,11 0.11 0.56 0.56 0.56 0.56 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 cle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 240 228 147 183 568 1068 824 880 `Ratio Prot c0.06 0,04 ) ' ' c0.09 c0.33 v/s Ratio Perm 0.02 0.24 0.18 0.11 atio 0.46 0,13 ' '� , " '0.20 0,26 0.43 0.60 0,32 011 Uniform Delay, d1 24.2 23.1 24.5 24.7 7.9 9.0 7.2 6.4 Progression Factor 1.00 1.00, 1,00 1.00 1.00 1,00 1.00 1.00 Incremental Delay, d2 1.4 0.3 0.7 0.7 0.5 0.9 0.2 0.1 Qt .(s) ' 25.5 23.3 „ ;.: 0`5.2 25.4 _ 8.4 9.9 ��; 7.5 6.4 Level of Service C C C C A A A A ,pi ach Delay O 24.7 :; . ....,..:: 25.4 9.5 7,0 Approach LOS C C A A HCM Average Control Delay 12.1 HCM Level of Service B HCM Volume to Capacity ratio ` 0.60 ,; Actuated Cycle Length (s) 60.6 Sum of lost time (s) 12.0 Intersection Capacity Utilization 65.3% ICU Level of Service C ,< , Analysis Period (min) 15 c Critical,Lane Group°" A. Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV Build.sy7 Future Conditions AMDHV South Village 2013 Build Future Conditions ,or- t IV. 1 WBL: NBR : NBT N R k3 Lane Configurations T +T Sign Control Stop Free Free �� r > 5 t � , BOO Grade 0% 0% 0% ..., .., me (veh/h) 73 174 517 106 61 193 Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 0-88 Hourly flow rate (yp0) 90 216 640 131 76 239 Pedestrians Lane Width (ft) 1 .. �� 0021" " Walking Speed (ft/s) Percent Blockage Right turn flare (veh) Median type " wonne Median storage veh) Upstream signal (ft) s pX, platoon unblocked vC,- conflicting volume 1096 706 �b vC1, stage 1 conf vol age 2 conf vol011 ,' aRN vCu, unblocked vol 1096 706 772 tC, (single (s) 6.4 6,2 tC, 2 stage (s) s .. 3.5 3.3 r p0 queue free % 58 51 91 cM cap G t v�hlh)a�,� �. 215;_,. r .xug3f Volume Total 306 772 315 Volume Left 90 0 70 Volume Flight 216 131 V yu1' 0 any z cSH 334 1700 843 d "e to Capacity 0.92 - 0.45 0.09;. Queue Length (ft) 227 0 7 Control Delay (s) 66.0 0.0 3.1' Lane LOS F A Approach Delay (s) 66.0 0.0 3.1 Approach LOS F ` rt1 Average Delay 15.2 tnfersehon Capacity Utlizatiti , 77.5% ICU Level of Service ,��. D Analysis Period (min) 15 iR i, Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV Build.sy7 Volume (vph) 36 116 11 32 148 67 43 235 94 37 50 14 Hourly flow rate (vph) 47 151 14 42 192 87 56 305 122 48 65 18 HCM Level of Service C Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV Build.sy7 Future Conditions AMDHV South Village 2013 Build Future Conditions Miveni M-109MEN13T 'N . . . ............ ' " Lane Configurations Ideal Flow (vphpl) 1900 1900 1900 igoo 1900 1900 Lane Width 12 12 12 12 10 14 Total Lost time (s) 4.0 4.0 4.0 4.0 4.0"AIMA,UMWOMN' ' Lane Util. Factor 1.00 1.00 0.95 1.00 0.95' Frt 1,� M 0.85 0.98 114t 1.00 1.00 A-M Flt Protected 0.95 1-00 1.00 0.95 1.00 Satd. Flow (prot) 1770 1583 3475 1652 3775 Me- M-1 M ftl ?V Flt Permitted 0.95 1.00 1.00 0.13 1.00 Satd. Flow (perm), 111,1",@-,,,_,,' 70 1583 3475 232 3775 Volume (vph) 176 247 1096 151 96 619 R&A How 95 0 0,95 0.95 0.95 0.95:'-""�" 10, 11 ON Growth Factor (vph) 109% 109% 109% 109% 109% 109% Adj. Flow (vph),,.' 202 283 1258 173 110 710 RTOR Reduction �v-(vph) 0 64 15 0 0 0 Lane Group Flow (vph) 202 219 1416 0 110 710 Turn Type Perm Perm Protected Phases 8 2 6 Permitted Phases 8 6 Actuated Green,,G (s) 12.1 12.1 37.0 37.0 37.0 1 Effective Green, g (s) 12.1 12.1 37.0 37.0 37.0 , Ratio` 0.21 0, ,,0.65 0.65 a 4. MR Clearance Time (s) 4.0 1 ';ktj 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3,0 3.0 3.0 3.0 Lane Grp Cap (vph) 375 335 2252 150 2446 y1s Ratio Prot 0,11 0A1 0:19 v/s Ratio Perm 0.18 c0.47 V/c Ratio 0.54 0.65 0.63, '0,73 0.29 NMI Uniform Delay, dl 20.0 20.6 6.0 6.7 4.4 Progression Factor 1,00 1.00 1.00 ,,," 1,00 1.00 Incremental Delay, d2 1.5 4.5 0.6 16.8 0.1 gir S) 21,5 25,1 Level of Service C C A C A Approach Dela ,,(*) -p- y 23,6 6.5,1 1% 011MAIN Approach LOS C A A M11p, J'Wrsection Surfim 11 M 9 �T HCM Average Control Delay 9.7 HCM Level of Service A HCM Volume to Capacity ratio 0.76 A"'!"'T If Actuated Cycle Length (s) 57.1 Sum of lost time (s) 8.0 jntersecfi or I ,-,n,,,, lization 64.7% ICU Level of Service CM M1 Analysis Period (min) 15 Future Conditions 01/15/2004 AMDHV 2008 Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 AMDHV Build.sy7 Future PMDHV South Village Build 2013 04/08/2004 Exisiting Conditions PMdhv CAMy Documentslsoburlingtonitraffic study12013 PMDHV.sy7 Volumes Future PMDHV South Village Build 2013 04/08/2004 len co ass ,� / �13 yr �19 Central Site Drive n Ve 189—,-7 w` 31 �r •. � T 152 rn COCO� rn N LL cu Q� Q CO Exisiting Conditions PMdhv CAMy Documents\soburlington\traffic study\2013 PMDHV.sy7 Volumes Future PMDHV South Village Build 2013 04rosi2004 txisiting Conditions PMdhv CAMy Documents\soburlington\traffic study\2013 PMDHV.sy7 Volumes Future PMDHV Build 2013 Q� O Q rr /M cV o "\-36 �-116Cheese Factory ory Rd `�Cr) South Village 04/08/2004 txisiting conditions PMdhv CAMy Documents\soburlington\traffic study\2013 PMDHV.sy7 Volumes Future PMDHV South Village Build 2013 04/08/2004 Exisiting Conditions PMdhv C:\My Documents\soburlington\traffic study\2013 PMDHV.sy7 Volumes Future ConditionsPMDHV South Village 2013 Build 04/14/2004 MN NBR, Lane Configurations t r T r t Idea! Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width 10 10 10 12 10 12 12 10 12 11 16 12 Total Lost time (s) 4.0 4.0 4.0 - 4.0 4.0 4.0 4.0 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 1.00 0,85 1.00 0,85' 1.00 0,94 1.00 0,97 Flt Protected 0.99 1.00 0.97 1.00 0.95 1.00 0.95 1.00 Satd. Flow (prat)' 1726 1478 1689 1583 1770 1626 1711 2042 Flt Permitted 0.92 1.00 0.55 1.00 0.29 1.00 0.46 1.00 Satd.,Flow.(perm) 1591 - 1478 960 >_ 1583 531 1626 833, , 2042 Volume (vph) 36 201 437 161 113 45 234 185 141 93 404 1 33 Peak -hour factor, PHF 0.93 0.93 ' 0.03 0.93 0.93 0.93 0.93 0,93 0.93 0.93 0.93 0.93 Growth Factor (vph) 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% ld). Flo(vph) 42 236 512 189 132 53 274 217 165 :_ 109 474 132 RTOR Reduction (vph) 0 0 204 0 0 34 0 33 0 0 12 0 Lane Group Flow (vph) 0 278 308 0 321 19 274 - 349 0 109, 594 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Actuated Green, ;G (s) 26.6 26.6 26.6 26.6 39.3 39.3 39.3 39.3 Effective Green, g (s) 26.6 26-6 26.6 26.6 39.3 39.3 39.3 39.3 fed g/C Ratio 0`36 0.36 036 0.36 0.53 053 0.53 : 0.53 Clearance Time (s) 4.0 4-0 4.0 4.0 4.0 4.0 4.0 4.0 1icle Extension (s) 3.0 3,0 3.0 3.0 ` 3.0 3.0 3.0 30 Lane Grp Cap (vph) 573 532 346 570 282 865 443 1086 v/s Ratio Prot 023 0.30 u v/s Ratio Perm 0.17 0.35 0.33 0.03 c0.52 0.13 v/c Ratio 0.49 0.58 0.93 0.03 0.97 0.40 0.25 0.55 3 Uniform Delay, d1 18.3 19.1 22.7 15.3 16.8 10.3 9.3 11.4 Progression Factor 1.00 1.00 1.00 1.00 1.00 1.00 1,00 1.00 Incremental Delay, d2 0.6 1.5 30.2 0.0 46.8 1.4 1.3 2.0 D ay (s) 19.0 20.6 '52.9 15.3 '63.6 11.7 ' 10.6 13:4 Level of Service B C D B E B B B Afsprnach Delay (s) .. _ 20.1 .�... 476 33 4 01 Approach LOS C D C B HCM Average Control Delay 25.6 HCM Level of Service _ C HCM'Volu ne to Capacity rati '`" j 0'47 n„ 101 Actuated Cycle Length (s) 73.9 Sum of lost time (s) .3�a .nd,. ;.�n�.r ,;,,, 8.0 Intersection Capacity Utilization 88.0% ICU Level of Service t �"�' . a ,� , Analysis Period (min) 15 L *X* Pt� pne Group RAW Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build 04/14/2004 IU[iveehn , . EBB = E6 f WB R , MA Lane Configurations T+ T T +T r flow (vphpl) kr,^'1900 1900 1900 1900 1900 1900 1900 "1900 1900 1900 1900 Lane Width 12 12 14 12 12 12 10 13 12 12 12 12 .. >. , °';' ` �t) 4.0 4.0 4.0 4.0 ' 4 A 4.0 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00; 087 1M 0.99 M'x' 1.00 0.85 Fit Protected 0.95 1.00 0.95 1.00 0.95 1.00 0.99 1.00 itd 1770 1629 1652 1903 1850 1583 Fit Permitted 0.95 1.00 0.91 1 M 0.28 1.00 0.92 1.00 Satd. Flow (perm) - _ 770 1631 . , 1693 - 1629 481 1903 1719 1583 Volume (vph) 155 28 139 17 12 61 91 214 17 72 476 188' Pea f 0.95 0.92 0.95 0.92 0♦92 0.92 0.95 0,95 0.92 0.92 0.95 0.95 Growth Factor (vph) 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 178 33 159 20 14 72 104 246 20 » 85 =, 546 216 RTOR Reduction (vph) 0 129 0 ^v 67 0 u 3 0 0 0 92 ,p Flow (vph) 178 63 Q 20 19 0 104 263 0 0 - 631 124 Turn Type Split Perm Perm Perm Perm �?atected Phases 4 4 8 2 6 Permitted Phases 8 2 6 6 , tUaGreen, G (s) 10.8 10.8 4.4 4A 30,5 30.5 30.5 30.5 Effective Green, g (s) 10.8 10.8 4.4 4.4 30.5 30.5 30.5 30.5 t /C Ratio 0.19 0.19 0,08 0.08 0.53 0.53 `` 0.53 0,53 Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 3.0 3.0 3,0 3.0 3.0 3.0 3.0 Lane Grp Cap (vph) 331 305 129 124 254 1006 909 837 *-Ratio Prot 0.10 c0.12 c0.05 0,14 v/s Ratio Perm 0.01 0.22 c0.37 0.14 vlc'Ragq, , 0.54 0.21 0,16 0,16 0.41 0,26 0,69 0,15 Uniform Delay, dl 21.2 19.8 24.9 24.9 82 7.4 10.1 7.0 Progression Factor 1,00` 1,00 1,00 1.00 1,00 1.00 1,00 1=,00 Incremental Delay, d2 1.7 0.3 0.6 0.6 1.1 0.1 2.3 0.1 * S) 2Z9 20.2 25.5 25.5:: ,: z,- 9.3 7,6 12A 7.0 Level of Service C C C C A A B A Yi Delay (s) 21:5 25.5 8.0 11A Approach LOS C C .... A B orsan SuMiary ` s HCM Average Control Delay 13.6 HCM Level of Service B "CM yme to Capacity ratio 0.68 Actuated Cycle Length (s) 57.7 Sum of lost time (s) 12.0 lnt=on Capcity Utilization 71 1 %o ICU Level of 5erv�ce C" E Analysis Period (min) _.. . 15 _.. ,.....s c ,Critical Lane Group AM Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build 04/14/2004 Lane Configurations Sign Control Stop Free Free Grade 0% 0% 0% Volume (veh/h,) 101 75 231 85 "0.88 161 441NEW Peak Hour Factor 0.88 0.88 0.88 0.88 0.88 Hourly flow rate (vph) ` 125 93 286 105 199 546-' Pedestrians Large Width (ft) - Walking Speed (ft/s) Percent Blockage' J. Right turn flare (veh) Median type Non" Median storage veh) Up� ream signal (ft) M pX, platoon unblocked �C conflicting volume" 1284'";` `'33� �� 391 ' Yea, I vC1, stage 1 conf vol .. vC2,,stage 2 conf vol vCu, unblocked vol 1284 339 391 tC,m d ie (s) 6A 6.2 4.1 tC, 2 stage (s) �... i 3.5 3.3 2.2` p0 queue free % 17 87 83 .' ty (veh/h) 151 704 1167 Volume Total 218 391' 746 Volume Left 125 0 199 J` fd Right 93 105 0 cSH 227 1700 1167 Volume to Capacity 0.96 0.23 0.1 Queue Length (ft) 213 0 15 play (s) 95.5 0.0 3.9 Lane LOS F A � r�och'Delay (s) 95.5 0.0 3.9 Approach LOS F Average Delay 17.5 Intersection Capacity Utilization' 75.0% ICU Level of Service D Analysis Period (min) 15 °;lYggLa,yYyy . v ev,.GK''L.9�, �wr, .x-_ vb e.,..xv9 s, .. , _, w n Rt. Ir ..✓JY�,v - Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build 04/14/2004 M6ver6 - BT Lane Configurations 4+ +T+ +T+ Sign Control -' Stop Stop Stop Stop` Volume (vph) 45 127 62 106 139 33 11 60 36 37 203 34 Peak Hour Factor 0.97 0.97 097 0.97 0.97 ' 0.97 0.97 0.97 0.97 0.97 097 0.97 Hourly flow rate (vph) 51 143 70 119 156 37 12 67 40 42 228 38 Volume Total (vph) 263 312 120 308 Volume Left (vph) 51 119 ':12 - 42 `" _ y Volume Right (vph) 70 37 40 38 JI e . , -0.09 0.04 -0 15 -0,01 Departure Headway (s) 5.7 5.7 6.1 5.8 � I ion, x 0.42 0.50 0.20 0.49 Capacity (veh/h) 580 588 502 575 ,61ay`(s) 12.7 14.2 10.6 14.3 w Approach Delay (s) 12.7 14.2 10.6 14.3 poach" L`OS B.. HCM Level of Service B Intersection Capacity Utilization 59.9% ICU 'Level of"Service Analysis Period (min) 15 i Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C.-\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Budd 04/14/2004 ,or- 'I- t 1 6 Lane Configurations tt Ideal Flow (vphpl) 1900 1900 1900 1900 ` 1900 1900 Lane Width 12 12 12 12 10 14 Total Lost time (s) 4.0 4.0 4.0 4.0 4.0 �. .. 'L ,, MUM qs M MM """ Lane UtiL Factor 1.00 1.00 0.95 1.00 0.95 Frt 1,00 0.85 0.98 1.00 1.00 Flt Protected 0.95 1.00 1.00 0.95 1.00 Satd Flow"( ot) 1770 1583 3463 1652 3775 } Flt Permitted 0.95 1.00 1.00 0.29 1.00 Satd. Flow (perm) 1770 1583 3463 501 3775 ".. Volume (vph) 206 93 677 114 151 1130 Peak-hour'fac HF ' 0.96; 0,96 0.96 0.96 0°96 , <0.96 Growth Factor (vph) 109% 109% 109% 109% 109% 109% Adj. Flow (vph) 234 106 769 129` 171 1283 RTOR Reduction (vph) 0 82 19 0 0 0 Lane Group Flow (vph) 234 24 879 0 171 1283 Turn Type Perm Perm Protected Phases 8 2 6 Permitted Phases 8 6 ta Actuated Green, G (s) _ 12.0 12.0 34.0'9 34.0 34 0 � �I Effective Green, g (s) 12.0 12.0 34.0 34.0 34.0 Actuated g/C Ratio 0.22 0.22 0,63 0.63 0.63 � Clearance Time (s) 4.0 4.0 4.0 4.0 4.0 Vehicle Extension (s) 3.0 ' 3.0 3.0 3.0;..v- :... Lane Grp Cap (vph) 393 352 2180 315 2377 v/s Ratio Prot c0.13 ' 0.26 0,34 v/s Ratio Perm 0.07 c0.34 Ratio 0,60 0,07 0.40 0,54 0.54 Uniform Delay, d1 18.8 16.6 5.0 5.6 5.6 Progression Factor I M 1.00 1,00 1.00 1.00 '; NI Incremental Delay, d2 2.4 0.1 0.1 1.9 0.2 Delay (s) 21.2 16.7 51 7.5 5,8 Level of Service C B A A A Approach` Delay (s) 19.8 ._ .. 5.1 .0 Approach LOS B A ""6A HCM Average Control Delay 7.5 HCM Level of Service A ,,ne to Capacity ratio 0.56 Actuated Cycle Length (s) 54.0 Sum of lost time (s) 8.0 �1#0 Ian Capacity Utilization 55.9% ECU" Level of Service B Analysis Period (min) 15 c :C"ritico.1 Lane Group i .. Exisiting Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Traffic Impact Study Addendum "South Village" Proposal: Mixed -Use; Residential, Agricultural & Educational Spear Street and Allen Road South Burlington, Vermont Addendum June 17, 2004 Prepared for: Mr. David Scheuer, President The RetroVest Companies 70 South Winooski Avenue Burlington, VT. 05401-3830 Prepared by TND Engineering Chester Chellman, P.E. 1270 Route 16 PO Box 388 Ossipee, NH 03864-0440 Telephone 603.539.5999 Fax 603.539.7912 Email chellmanCo)TNDEngineerinq.com This information is submitted to supplement the Traffic Impact Study dated April 8, 2004. South Village Traffic Impact Study Addendum June. 2004 Intersection Sight Distances: The Project proposes three accesses to Spear Street- North, Central (at Allen Road) and South. Civil Engineering Associates measured sight distances at each proposed entry. Sight Distances (feet) Intersection Northerly Southerly North Central South 915 825 750 1500 1260 1250 In order for a driver to stop a moving vehicle, a three -step process ensues of- perception of the problem, reaction (braking of the vehicle), and then the actual stopping of the vehicle. These steps are all summed in what, from a design perspective is termed stopping sight distance. Spear Road is posted at 35 mph (56 km/hr). For a design speed of 40 mph, recommended stopping sight distance is 305 feet.' Recommended sight distances for turns onto a major road at stop -controlled intersections range from values of 130 to 170 feet,2 to 445 feet.3 Sight distances in all cases at the proposed South Village accesses are adequate. At the central site access drive at the intersection of Allen Road, both northerly and southerly sight distances, while adequate on both instances, may be improved by the elimination of existing vegetation. ' A Policy on Geometric Design of Highways and Streets, 4"' Edition, American Association of State Highway and Transportation Officials, , Washington, DC, 2001, Exhibit 3-1 p. 112-, hereafter "Policy" 1 Traffic Engineering Handbook, 5"' EditioOnlnstitute of Transportation Engineers, Washington, DC, 1999, Table 11-15, p. 376. 'Policy, Ibid, Exhibit 9-55, p. 665. Page 2 South Village Traffic Impact Study Addendum June.2004 ADDITIONAL ACCIDENT ANALYSIS Crash data was requested from the VAOT, the City of South Burlington and the Town of Shelburne police departments for the most recent five-year period. The City recently changed computer systems, such that researching crash data before the summer of 2003 has become less computer -based and more difficult to research. A telephone interview with the South Burlington police department determined that, in the time period from July 23, 2003 to April 15, 2004 there were 2 minor accidents and one property damage accident at the Spear Street and Allen Road intersection. VAOT data, available online was reviewed for the period starting January 1997 to December 2001. Wilbur Smith & Associates obtained data from the City of South Burlington data for the period starting January 1998 to December 2002 The VAOT data indicated a total of 10 accidents along Spear Street between Main Street and just south of the Swift Street intersection during the five-year period between 1997 and 2001. Of the 10 accidents, 4 were reported at the Spear Street/Swift Street intersection. Data was also secured from the Shelburne police for the Spear/Barstow and Barstow/Dorset intersections. No severe accidents were recorded for the four years searched, while 2 "struck by deer" incidents were recorded, one at each Shelburne intersection. Critical Intersection Accidents AADT Rate Rate Spear & Swift 26 26,442 0.90 0.89 Spear & Allen 9 17,150 0.48 Spear & Barstow 3 7,400 0.28 Barstow & Dorset 4 5,500 0.50 [1�0101 1.23 1.33 Source Fuss & O'Neill- 3 years Fuss & O'Neill- 3 years CCMPO & Shelburne Police- 4 years CCMPO & Shelburne Police- 4 years Page 3 South Village Traffic: Impact Study Addendum June, 2004 Note that the Swift and Allen Road intersection critical rates are slightly different from the values calculated by Fuss & O'Neill, due to a new statewide average rate of 0.411 accidents per million miles of travel reported by VAOT this month. Queuing Analysis/ Left Turn Lanes. In the report dated April 8, a left turn lane warrant analysis was completed for the site drive at Allen Road. This particular analysis was completed prior to the signal warrant analysis, which determined that a signal is warranted at this intersection. The general standard for a separate left turn lane at a signal is to provide one if left turning volumes exceed 100 vehicles per hour.4 Left turn lanes may also be provided, based on judged need for lower volumes. Here, the AM volumes are approximately 50 left turning entering vehicles, increasing to approximately 80 in the PM peak period. Part of the design considerations include queuing analysis for each approach. At the central proposed entrance at Allen Road, separate southbound left turn entering lane and the westbound exiting left turn lanes were considered and analyzed for queuing to determine the effects of each and appropriate storage lane lengths of each for future conditions. Both the AM and PM future conditions were studied using both Synchro (Highway Capacity Manual techniques) and SimTraffic (micro simulation techniques) modeling programs. Multiple runs in SimTraffic showed that there is no overall benefit to providing a separate southbound left turning lane. The maximum observed queues for southbound left turning traffic in the PM peak period were 164 feet, with average queues being 103 feet for the same movement. With the additional left turn lane, average queues drop to 45 feet for the southbound left, but at the expense of increasing northbound traffic queues. ` Policy, lbid p. 688-689. Page 4 South Village Traffic Impact Study Addendum June, 2004 Intersection Details Spear Street/Allen Road Intersection This intersection should be configured so that the westbound roadway conforms with the BV-66 section approved by the City of South Burlington in December, 2002. The westbound left turn lane should be configured to be 75 feet in length, and 10-11 feet in width. Signal Optimization The analysis previously submitted did not optimize the signal timing plans for any of the signals analyzed, to reflect existing and future conditions in the same fashion as with prior studies. Optimization of the Swift Street/Spear Road intersection was analyzed for future PM peak hour conditions, for this Addendum. Presently, this signal has a PM cycle length of 78 seconds-, initial review shows that optimal cycle length may be 55 seconds. Future conditions for the existing cycle length shows that an overall intersection LOS C will be achieved, but the northbound left turn movement will operate at LOS F. With optimization, the overall intersection still operates at a slightly better LOS C, but the northbound left improves to LOS E and the westbound through degrades to LOS E. The following pages provide additional detail, the optimized files have "2013 Build -Opt" in the upper left header area of each page. Page 5 Future ConditionsPMDHV 2013 Build South Village 06/ 17/2004 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations t t r t t Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 190C Lane Width (ft) 10 10 10 12 10 12 12 10 12 11 16 12 Storage Length (ft) 0 150 75 125 75 0 80 0 Storage Lanes 0 1 0 1 1 0 1 0 Total Lost Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Leading Detector (ft) 50 50 50 50 50 50 50 50 50 50 Trailing Detector (ft) 0 0 0 0 0 0 0 0 0 0 Turning Speed (mph) 15 9 15 9 15 9 15 9 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.850 0.850 0.935 0.967 Flt Protected 0.993 0.971 0.950 0.950 Satd. Flow (prot) 0 1726 1478 0 1688 1583 1770 1626 0 1711 2041 0 Flt Permitted 0.916 0.570 0.259 0.446 Satd. Flow (perm) 0 1593 1478 0 991 1583 482 1626 0 803 2041 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 319 53 70 26 Headway Factor 1.09 1.09 1.09 1.00 1.09 1.00 1.00 1.09 1.00 1.04 0.85 1.00 Link Speed (mph) 30 30 30 30 Link Distance (ft) 328 273 244 346 Travel Time (s) 7.5 6.2 5.5 7.9 Volume (vph) 36 201 437 161 113 45 234 185 141 93 404 113 Peak Hour Factor 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 Growth Factor 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% Adj. Flow (vph) 42 236 512 189 132 53 274 217 165 109 474 132 Lane Group Flow (vph) 0 278 512 0 321 53 274 382 0 109 606 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Detector Phases 4 4 4 8 8 8 2 2 6 6 Minimum Initial (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Minimum Split (s) 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 Total Split (s) 35.0 35.0 35.0 35.0 35.0 35.0 43.0 43.0 0.0 43.0 43.0 0.0 Total Split (%) 44.9% 44.9% 44.9% 44.9% 44.9% 44.9% 55.1 % 55.1 % 0.0% 55.1 % 55.1 % 0.0% Maximum Green (s) 31.0 31.0 31.0 31.0 31.0 31.0 39.0 39.0 39.0 39.0 Yellow Time (s) 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 All -Red Time (s) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 Lead/Lag Lead -Lag Optimize? Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None None Max Max Max Max Walk Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 0 0 0 Act Effct Green (s) 26.6 26.6 26.6 26.6 392 39.2 39.2 39.2 Actuated g/C Ratio 0.36 0.36 0.36 0.36 0.53 0.53 0.53 0.53 v/c Ratio 0.49 069 0.90 0.09 1.07 0.43 0.26 0.55 Control Delay 20.4 11.6 40.8 5.0 101.1 11.2 13.0 14.4 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C \My Documents\soburlingtonitraffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build 06/17/2004 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Total Delay 20.4 11.6 40.8 5.0 101.1 11.2 13.0 14.4 LOS C B D A F B B B Approach Delay 14.7 35.7 48.8 14.2 Approach LOS B D D B Intersection Summary Area Type: Other Cycle Length: 78 Actuated Cycle Length: 73.9 Natural Cycle: 55 Control Type: Semi Act-Uncoord Maximum v/c Ratio: 1.07 Intersection Signal Delay: 26.5 Intersection LOS: C Intersection Capacity Utilization 88.0% ICU Level of Service E Analysis Period (min) 15 Splits and Phases: 1: Swift St & Spear St 02 04 43 s 35 s I • 06 #- 08 43s I 135s Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build 06/17/2004 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations t r t r t t Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width (ft) 10 10 10 12 10 12 12 10 12 11 16 12 Grade (%) 0% 0% 0% 0% Storage Length (ft) 0 150 75 125 75 0 80 0 Storage Lanes 0 1 0 1 1 0 1 0 Total Lost Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Leading Detector (ft) 50 50 50 50 50 50 50 50 50 50 Trailing Detector (ft) 0 0 0 0 0 0 0 0 0 0 Turning Speed (mph) 15 9 15 9 15 9 15 9 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Ped Bike Factor Frt 0.850 0.850 0.935 0.967 Flt Protected 0.993 0.971 0.950 0.950 Satd. Flow (prot) 0 1726 1478 0 1688 1583 1770 1626 0 1711 2041 0 Flt Permitted 0.916 0.570 0.259 0.446 Satd. Flow (perm) 0 1593 1478 0 991 1583 482 1626 0 803 2041 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 319 53 70 26 Headway Factor 1.09 1.09 1.09 1.00 1.09 1.00 1.00 1.09 1.00 1.04 0.85 1.00 Link Speed (mph) 30 30 30 30 Link Distance (ft) 328 273 244 346 Travel Time (s) 7.5 6.2 5.5 7.9 Intersection Summary Area Type_ Other Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:AMy Documentslsoburlington\trZittlC study\2013 PMDHV Build sy7 Future ConditionsPMDHV South Village 2013 Build 06/17/2004 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Volume (vph) 36 201 437 161 113 45 234 185 141 93 404 113 Confl. Peds. (#/hr) Confl. Bikes (#/hr) Peak Hour Factor 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 Growth Factor 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% Heavy Vehicles (%) 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% Bus Blockages (#/hr) 0 0 0 0 0 0 0 0 0 0 0 0 Parking (#/hr) Mid -Block Traffic (%) 0% 0% 0% 0% Adj. Flow (vph) 42 236 512 189 132 53 274 217 165 109 474 132 Lane Group Flow (vph) 0 278 512 0 321 53 274 382 0 109 606 0 Intersection Summary Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build 06/17/2004 -1, -► � ir �+- I- 4� Lane Group EBL EBT EBR WBL WBT WBR NBL NBT SBL SBT Lane Configurations t r t r t t Volume (vph) 36 201 437 161 113 45 234 185 93 404 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Detector Phases 4 4 4 8 8 8 2 2 6 6 Minimum Initial (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Minimum Split (s) 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 Total Split (s) 35.0 35.0 35.0 35.0 35.0 35.0 43.0 43.0 43.0 43.0 Total Split (%) 44.9% 44.9% 44.9% 44.9% 44.9% 44.9% 55.1 % 55.1 % 55.1 % 55.1 % Yellow Time (s) 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 All -Red Time (s) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 Lead/Lag Lead -Lag Optimize? Recall Mode None None None None None None Max Max Max Max Act Effct Green (s) 26.6 26.6 26.6 26.6 39.2 39.2 39.2 39.2 Actuated g/C Ratio 0.36 0.36 0.36 0.36 0.53 0.53 0.53 0.53 v/c Ratio 0.49 0.69 0.90 0.09 1.07 0.43 0.26 0.55 Control Delay 20.4 11.6 40.8 5.0 101.1 11.2 13.0 14.4 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Total Delay 20.4 11.6 40.8 5.0 101.1 11.2 13.0 14.4 LOS C B D A F B B B Approach Delay 14.7 35.7 48.8 14.2 Approach LOS B D D B Intersection Summary Cycle Length: 78 Actuated Cycle Length: 73.9 Natural Cycle: 55 Control Type: Semi Act-Uncoord Maximum v/c Ratio: 1.07 Intersection Signal Delay: 26.5 Intersection LOS: C Intersection Capacity Utilization 88.0% ICU Level of Service E Analysis Period (min) 15 Splits and Phases: 1: Swift St & Spear St 43 35 r ♦- 0e. or; U < :5 Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlindton\traffic study\2013 PMDHV Build sy7 Future ConditionsPMDHV South Village 2013 Build 06/17/2004 -A ,-'* f- .- A, 4\ 1 1 1 Lane Group EBL EBT' EBR WBL WBT WBR NBL NBT SBL SBT Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Minimum Initial (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Minimum Split (s) 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 Total Split (s) 35.0 35.0 35.0 35.0 35.0 35.0 43.0 43.0 43.0 43.0 Total Split (%) 441.9% 44.9% 44.9% 44.9% 44.9% 44.9% 55.1 % 55.1 % 55.1 % 55.1 % Maximum Green (s) 31.0 31.0 31.0 31.0 31.0 31.0 39.0 39.0 39.0 39.0 Yellow Time (s) 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 All -Red Time (s) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 Lead/Lag Lead -Lag Optimize? Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Minimum Gap (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Time Before Reduce (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Time To Reduce (s) 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Recall Mode None None None None None None Max Max Max Max Walk Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 0 0 0 90th %ile Green (s) 31.0 31.0 31.0 31.0 31.0 31.0 39.0 39.0 39.0 39.0 90th %ile Term Code Max Max Max Max Max Max MaxR MaxR MaxR MaxR 70th %ile Green (s) 31.0 31.0 31.0 31.0 31.0 31.0 39.0 39.0 39.0 39.0 70th %ile Term Code Hold Hold Hold Max Max Max MaxR MaxR MaxR MaxR 50th %ile Green (s) 31.0 31.0 31.0 31.0 31.0 31.0 39.0 39.0 39.0 39.0 50th %ile Term Code Hold Hold Hold Max Max Max MaxR MaxR MaxR MaxR 30th %ile Green (s) 25.2 25.2 25.2 25.2 25.2 25.2 39.0 39.0 39.0 39.0 30th %ile Term Code Hold Hold Hold Gap Gap Gap MaxR MaxR MaxR MaxR 10th %ile Green (s) 16.4 16.4 16.4 16.4 16.4 16.4 39.0 39.0 39.0 39.0 10th %ile Term Code Hold Hold Hold Gap Gap Gap MaxR MaxR MaxR MaxR Intersection Summary Cycle Length: 78 Actuated Cycle Length: 73.9 Control Type: Semi Act-Uncoord 90th %ile Actuated Cycle: 78 70th %ile Actuated Cycle: 78 50th %ile Actuated Cycle: 78 30th %ile Actuated Cycle: 72.2 10th %ile Actuated Cycle: 63.4 Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C \My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build -Opt 06/17/2004 Lane Group EBL EBT EBR WBL WBT WBR NBL NBT NBR SBL SBT SBR Lane Configurations t r T r ►� T ►� t Ideal Flow (vphpl) 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 Lane Width (ft) 10 10 10 12 10 12 12 10 12 11 16 12 Storage Length (ft) 0 150 75 125 75 0 80 0 Storage Lanes 0 1 0 1 1 0 1 0 Total Lost Time (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Leading Detector (ft) 50 50 50 50 50 50 50 50 50 50 Trailing Detector (ft) 0 0 0 0 0 0 0 0 0 0 Turning Speed (mph) 15 9 15 9 15 9 15 9 Lane Util. Factor 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 Frt 0.850 0.850 0.935 0.967 Fit Protected 0.993 0.971 0.950 0.950 Satd. Flow (prot) 0 1726 1478 0 1688 1583 1770 1626 0 1711 2041 0 Fit Permitted 0.914 0.567 0.297 0.480 Satd. Flow (perm) 0 1589 1478 0 986 1583 553 1626 0 864 2041 0 Right Turn on Red Yes Yes Yes Yes Satd. Flow (RTOR) 340 53 105 39 Headway Factor 1.09 1.09 1.09 1.00 1.09 1.00 1.00 1.09 1.00 1.04 0.85 1.00 Link Speed (mph) 30 30 30 30 Link Distance (ft) 328 273 244 346 Travel Time (s) 7.5 6.2 5.5 7.9 Volume (vph) 36 201 437 161 113 45 234 185 141 93 404 113 Peak Hour Factor 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 0.93 Growth Factor 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% 109% Adj. Flow (vph) 42 236 512 189 132 53 274 217 165 109 474 132 Lane Group Flow (vph) 0 278 512 0 321 53 274 382 0 109 606 0 Turn Type custom custom Perm Perm Perm Perm Protected Phases 8 2 6 Permitted Phases 4 4 4 8 8 2 6 Detector Phases 4 4 4 8 8 8 2 2 6 6 Minimum Initial (s) 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 Minimum Split (s) 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 20.0 Total Split (s) 22.0 22.0 22.0 22.0 22.0 22.0 33.0 33.0 0.0 33.0 33.0 0.0 Total Split (%) 40.0% 40.0% 40.0% 40.0% 40.0% 40.0% 60.0% 60.0% 0.0% 60.0% 60.0% 0.0% Maximum Green (s) 18.0 18.0 18.0 18.0 18.0 18.0 29.0 29.0 29.0 29.0 Yellow Time (s) 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 3.5 All -Red Time (s) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 Lead/Lag Lead -Lag Optimize? Vehicle Extension (s) 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 Recall Mode None None None None None None Max Max Max Max Walk Time (s) 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 5.0 Flash Dont Walk (s) 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11.0 11 0 Pedestrian Calls (#/hr) 0 0 0 0 0 0 0 0 0 0 Act Effct Green (s) 18.0 18.0 18.0 18.0 29.0 29.0 29.0 29.0 Actuated g/C Ratio 0.33 0.33 0.33 0.33 0.53 0.53 0.53 0.53 v/c Ratio 0.53 0.72 0.99 0.10 0.94 0.42 0.24 0.55 Control Delay 19.7 12.8 73.1 5.2 58.0 7.3 8.8 10.5 Queue Delay 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C.AMy Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Future ConditionsPMDHV South Village 2013 Build -Opt ♦ 0I6/17/2004 Lane'Group Lane Configurations Ideal Flow (vphpl) Lane Width (ft) Grade (%) Storage Length (ft) Storage Lanes Total Lost Time (s) Leading Detector (ft) Trailing Detector (ft) Turning Speed (mph) Lane Util. Factor Ped Bike Factor Frt Fit Protected Satd. Flow (prot) Fit Permitted Satd. Flow (perm) Right Turn on Red Satd. Flow (RTOR) Headway Factor Link Speed (mph) Link Distance (ft) Travel Time (s) Area Type: t r t r t t 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 1900 10 10 10 12 10 12 12 10 12 11 16 12 0% 0% 0% 0% 0 150 75 125 75 0 80 0 0 1 0 1 1 0 1 0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 50 50 50 50 50 50 50 50 50 50 0 0 0 0 0 0 0 0 0 0 15 9 15 9 15 9 15 9 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.850 0.850 0.935 0.967 0.993 0.971 0.950 0.950 0 1726 1478 0 1688 1583 1770 1626 0 1711 2041 0 0.914 0.567 0.297 0.480 0 1589 1478 0 986 1583 553 1626 0 864 2041 0 Yes Yes Yes Yes 340 53 105 39 1.09 1.09 1.09 1.00 1.09 1.00 1.00 1.09 1.00 1.04 0.85 1.00 30 30 30 30 328 273 244 346 7.5 6.2 5.5 7.9 Other Future Conditions 01/15/2004 PMdhv Retrovest TND Engineering C:\My Documents\soburlington\traffic study\2013 PMDHV Build.sy7 Feb CO 2005 1r10PM THE RETROUEST GOMPnNIES 8028S36323 fo.1 'V.Qb 08 05 C I t D2 � r 0o Pa o3 s�p_ 7912 F1 . q01 127o Route 18, P',O.Box 388 Ossipee, NH 03884 TND Engineering Ph 803.539,5999 fax 603.539.7912 Z CkS K 1. 3� 9Y� •Goo ftx -i3 31, Tog Jon DIWch From: Rick Gne:lli Pam 802-985-2271 Piles: Phonsr 603.5v9-5999 Data! 02108r2005 RM CCg ❑ Unlerrt x Po► Riratvw► M Plowe Comment ❑ Please Reply 0 Pl.m® Recycle ! Coreenti. . or The fall mng pages, ;n order, t oe lave accirms afi (or s1 bast most) of ftr final iast►a& regarding South Vill's TIS, 1) A gnpic show" tN Pro)wcl'a PM traffic turning movwneri% at ttae site &Nes, 21, A pAin view printed from Synchro anowirg the same iaorrne small rounding differorces duQ to 1.C4 future growth factor). 3) 2008 Phi HW anaiytais of the Sot m dri+re at SpeW; i.OB B (no eha.ni 4) 2008 PNI HCM ana"is of the, North drive at $peer; _OS 0 (no change), 5) Fut ry 2008 Speer & Swift No Broils with tno weisumna aoproaahsstaed (1$ft lUrn lane) and the NS as beforei retisollnq your "ulnae' Qhfei sheets, LOS 8 (irnproveo from -OS C) 8) Sa'r'ia as 5, Build; LOS C (IrV"ed f•om LOS D) 7) Future 2008 Speer & Swift No Build with the ac"d cartes (N6 through, 5 (now) 8) Fuwre 2008 S%wr & Swift Build w11h the added lanes (1i :hroui eta) LOS B (now). 0) Future 2013 PAR 8ne drives pion view turning -movements 10) rICM anaiyes of tie aouth drive at Bpear; LOS 3 (no *hangs). 11) HCM arish/sia of that North drive at Spear; LOS ^ (no cnanpe• summary 'aflecled LOS 0, but that Will, an error). 12) FuVe 2C13 Spau & Swift No Build wth the westbouna aporoaches fixed (►ail ,urn lane) and the NS ale before- reMwtlr)g your "minor" changes sneers. LOS B (imp!aysd from LOS C) 13`, Sarno ais 12. Buld; LCS C (improved trorr LOS D) 14) Future 20'3 Spear & Swfin No Hund with the added lines LOSS (rww). 15) Future 20' 3 Spear & Swift Build witb Ine added laneai LOS C (near) 1s) Futurr! 2008 AM No Build wltn changed lanes G Spear & Swlltt LOS C (improy+ad) 17) Future 2038 AM Rtriid wits chargod tares LOS D (no charge) Feb 08 2005 =:19PM THE RETROVEST COMPRfyIES 802Ag38323 'Oeb 08 05 0 i s D9p Goa 5:a_ )7912 F. 2 p.2 February 8, 2005 18) I:utuie 2008 AM He Build with added Iervs 0 Spoor & Swift LOS C (new) 19) F4itxe 2CO6 AM Build wRh changed lases 6 Spear 9 Swit LOS D (new) 20) Future 203 AM No Duld with ohenged lanes 0 Spoor &Swift LOS D Omproved) 21) Future 203 AM Built %Ah changed lamp 0 Spear & SWP LOS Z (Improved) 22) Future 2013 AM No Budd with added lanes 12 Spear & Swift LOS C (new) 23) FUIWO 2013 AM %did wRh added lanes 0 6paar & SwiP, LDS D (new) 24) Summary tabs of levels of service I wRl have to follow up Wth at summary, but I thick all is anplybefter then irftklly rep"d, RiCk 0 Pbpe 2 Feb 06 2005 1:19PM THE RETROVEST COMPRNIES BOPP930323 Pub 09 05 O 1 t 07N 1 603 50% - ''7332 W W L6 li LN W W L6 F b W d aaaa � w Q mmmao � z c u IL&6 UL.L fLJgoLA-m y.. W u m Da in V mmui u' Um W6 W etm moa uuv Lin poWm u to u uvAin Fuss & O'Neill Inc. MEMORANDUM TO: Brian Robertson South Burlington Department of Planning & Zoning FROM: Jon Dietrich, P.E. DATE: February 4, 2005 RE: Request for Waivers South Village Preliminary Plan (Master Plan) Submittal The following summarizes our understanding of the Design Waivers as reviewed and discussed, and our related recommendations. A. Minimum Pavement Widths For Collector 1. Min. of 20 ft. at Wetland Crossings: Applicant to provide guardrail setback (if guardrail required) sufficient for snow storage and roadside clearance. 2. 28 ft. (2-14 ft. lanes) for A Street (Section BV-66); -no on -street parking on this section 3. Min. of 20 ft. at bulbouts -along the Section ST-60P in center of project 4. Min. of 26 ft. for "collector" routes -minimum design speed to be 25 mph -A,D, and E Streets, in particular, are to have sections where on -street parking is restricted and/or prohibited, as discussed with City staff, near intersections, in front of the proposed School, and at other areas as indicated on a parking location and signage plan to be provided by the applicant in subsequent design review stage. -all public streets will be subject to City's winter parking ban regulations. B. Minimum Pavement Width For Local Streets 1. Minimum of 20 ft. at Wetland Crossings -On-street (curbside) parking should be prohibited along these sections, particularly on curved sections of the ST-60 and ST-50 roadways 2. Min. of 26 ft. with marked parking on one side 3. Min. of 24 ft. with no marked parking -On-street parking should be prohibited along the RD-50 section (V Street) C. Minimum Centerline Radius of Horizontal Curves For local streets with a design speed of 25 mph, recommend using minimum centerline radius of 180 ft. (per ITE using coefficient of side friction of 0.252 and cross -slope of-0.02). C Documents and Settings\brobertsowLocal SettingsUemporary Internet Files\OLK138\MEMORANDUM24-05.doc Fuss & O'Neill Inc. Brian Robertson February 4, 2005 Page 2 2. For collector streets with likely speed of 30 mph, minimum centerline radius recommended is 300 ft. unless roadway curve is otherwise posted for lower speed to correspond with smaller radius. D. Minimum Tangent Length Between Curves 1. Based on target speeds of 25 mph or less, and no superelevation on curves the minimum tangent length should be 50 feet. E. Minimum Distance Between Centerline Offsets for Local Streets 1. Specific distances requested from waiver for certain local street intersections appear allowable, based on anticipated low traffic volumes; specific locations/offsets based on preliminary plans are contained in memo from Dave Marshall dated 2/2/2005 (attached). F. Vertical (Stopping) Sight Distance 1. Stopping sight distance for proposed street intersections at Spear Street should not be waived (i.e. should be based on operating speeds on Spear Street). 2. For on -site collector and local streets with posted speeds of no greater than 25 mph, the recommended minimum stopping sight distance is 150 feet. G. Horizontal (Corner) Sight Distance 1. Corner (intersection) sight distance at the intersections of the proposed site roadways with Spear Street shall not be waived, but should be based on actual speed conditions on Spear Street and any proposed traffic control signage at the intersection. 2. On internal South Village intersections with collector roads (i.e. A Street, D Street, E Street), the minimum corner sight distance should be 280 feet based on a speed of 25 mph. Because of building features, landscaping and on - street parking yet to be detailed, the ability to meet intersection sight distance minimums needs to be evaluated further in subsequent design stages when possible need for traffic control (i.e. STOP signs or other intersection controls) can be better defined. At minimum, stopping sight distance requirements should be met at intersections based on expected operating speeds of on -site traffic. H. Other 1. intersection traffic control signage and markings need to be considered and provided to City Staff in more detail in -subsequent design stages for certain sharp curves on roadway alignments including: a. D Street just South of E Street. b. Mid -section of M Street c. Mid -section of F Street CADocuments and Settings\brobertson\Local Settings\Temporary Internet Files\OLK138\MEMORANDUM24-05.doc Fuss & O'Neill Inc. Brian Robertson February 4, 2005 Page 3 d. Mid -section of D Street (at north end) These locations do not meet minimum curve radii and should be treated more as intersections. 2. Fire/emergency equipment traffic circulation: on -street parking near intersections and some intersection area widening may be necessary to accommodate the City's fire truck turning movements (e.g. boulevard island cutback at intersection of A Street and B Street; intersection of A Street and D Street; mid -section curve on F Street.) Subsequent intersection and roadway design plans need to be reviewed and approved by City staff/officials. Attachment C: Bruce Hoar Rick Chellman Dave Marshall CADocuments and Settings\brobertson\Local SettingsUemporary Intemet Files\OLK138\MEMORANDUM2-4-05.doc Page I of 3 don Dietrich - R,1-4. South Viiia-c ram: "Dave i'viarshall" <dmarshall(u cea -vt.com> To: "'Dave Marshall"' <dmarshall@cca-vt.corn>, <JDietric@fando.com:�> Date: 2/2/2005 8:54:16,kMi Subject: IRE: South Village CC: "'Rick Chellman"' <chel1man@worldpath.net>, "'Mh@Retrovest. Corn"' <mh@retrovest.Loni>, "'David.. <ds@retrc)vest.com> Jon - here is prograsspian showing the interrelationship ofthe propo sed streets and street parkiing progrim. The 3ignage was an issue in order to make the a ,, rograrn war,,<, therefore ,we have 3hiclisded the parking signing. This plan will uffimatpiy be expanded to inciude stop signs., street signs, Aiarning -Signs, etc, David S. ' 4arshall, P.E. Civil Engineering Associates, Inc. 928 Falls Road, PO Box 485 Shelburne, VT 05482-0485 P 802-995-2323 F 802-985-2271 dmarshall@cea-vt.com -----Original Message ----- Prom: Dave Marshall (mailto.-drTiarshall@cea-.vt.com] Sent: Monday, January 31, 2005 5:07 PM To: 'JDietric@fando.com' Cc, 'Rick Chellman'; 'Mh@Retrovest. Corn'; 'David' Subject* RE: South Village Jon - Regarding item 25 - specific detail /locations of the intersections where waivers from the centerline offset standard are requested; We offer the following list for your review which ',Uill be formally submitted to you: C Street to D Street Along F Street - 145' G Street to C Street Along F Street - 150' G Street to B Street Along F Street - 145' Common Lane (South) to E Street Along E Street - 60' Common Lane (South) to E Street Along D §treet - 86' Common Lane (North) to A Street Along,A Street - 50' Common Lane (North) to A Street Along B Street - 190' Regarding Item 29 - removal of some on -street parking near intersections and entrance roadways CEA is preparing a plan that shows the revised on -street parking coupled with the proposed signing plan. We hope to send this out on Tuesday Night as a pdf for you to review. David S. Marshall, P.E. Civil Engineering Associates, Inc. 928 Falls Road, PO Box 485 filc:IIC:\Docu-nents%20and'Yo2OSet-tings\_iond\Local%2OSettings\TeTnp\GW)OOOOl-H—iM 2/2/2005